GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

NFATC1
nuclear factor of activated T cells 1

Gene
Official SymbolNFATC1
Official Full Namenuclear factor of activated T cells 1
CGNC ID9602
also known asnuclear factor of activated T-cells, cytoplasmic 1|nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_418906
PolypeptideXP_418906
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4772ENSG00000131196MIM:600489
Mouse18018ENSMUSG00000033016All phenotypic alleles (7):Targeted, knock-out(3) Targeted, other(4) MGI:102469
Xenopus780197, 444346876755
Zebrafish568315ENSDARG00000036168ZDB-GENE-060503-677ZFIN:ZDB-GENE-060503-677
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420815
Ensembl Gene
KEGGgga:420815
GEISHA IdNFATC1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCCTTCCACTGCCACTTTGAACTTAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGCGATGTCTGTTTCTCCCTTCCGcDNA Template Length1207
Forward cDNA Template Probeshow
CCCCTGCGATCTCGTCGCGTTCGGTGTCAATTTCTGAACTTAATATCCCATCACACGTCAAGGGTTGGCTTCTCATGTT
TTTTCTCCTGGAAAATGTGGGATTTCCAGACTTTGGTGTTGGAAAGTATTGTTTCGTGGCTGGTGGTGGAAACAGTCTT
CCCAGTGATTCGATGAACCTGGTAGAAAGCATGGGGTCGCAGCACGCGGTCGTCTGCAGTCCCAATGAACAGCTGTAGC
GTGAGAGGCTCGCTTTCTAAGTAACCATGTAGCTGTACAATAGGGTGGCCCCCAGCAGATGCCTTCACAGCCCCTCGAC
TGCCTTCTGTCTCATAATGAGCTCGGTGGTGGGATTTCTGCTGCACTTCAATACGCAGTTCATAAGGTCCTGAGTGAGA
CGGCAGCTGCCAATCAAGGGCAGGCAGGGATGGGCTCATGTAGGACGTACGCGACAGAGACTTTGGTTTGGCCCACTGG
TACCGATGCTGTGGCACAAACAAATACTGCTCGCAGAAGTTTCCTTTCCTGATATGTTGAAAGCTAGAGAAGTCTTCTG
GTGACAAATCGGCAGTTGGCGATATGTTCCCATGGTCCTCGCCAGCCGGTTCAGTTTTGAGAGTCATGGACGGGGTGTG
GTCAATGGCTGTCTTCCTTGACTTGATGGAAATCCCATCATTCATATCAATTGTGCTGTCGGTGGTGAGAACATTTATG
GCAGCCCCAATGGCAGAGCTGGTATACTGGTTGGTGTTTCCCCCCCACGTCCTCATCTTTAACACTCCCCCCCCGTGAG
TTTTGCTGTAAAAGCCTGGGGGAAGTGATTTGGTAAATAATACGTCCGCCCGCCCTTTGAGGCTGAACTTTCTCTTTTT
TGCCGGGAAAATGAATGCCTTGGAGCGCCAACCCCCCAACCCAGTTTTCCTTTTTTTATCCTCGTCCTGGGAAATTTCC
AATGGCAATTTCCTTTGAAGAACATAAAAAAAATGCAGGGCACCCACGCCCCCCTTGGTACCCTCCCTCTTTGTCGTGG
CCTTTGGAGAGCCCCCCGCGCCCCGCCCCGAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Lateral Plate Mesoderm
Primitive Streak
 
7-12
stage 7
stage 8
stage 9
stage 10
stage 10
stage 11
stage 11
stage 12
Amnion
Blood Islands
Blood Vessels
Endocardium
Extraembryonic Mesoderm
Headfold
Heart
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Somites
extraembryonic endoderm
Low level expression in the Lateral Plate Mesoderm.
Low level expression in the Paraxial Mesoderm and Lateral Plate Mesoderm.
13-18
stage 13
stage 16
stage 18
stage 18
Ear/Otic Placode
Endocardium
Heart
Neural Plate/Tube
 
19-24
stage 19
Ear/Otic Placode
Endocardium
Heart
 
25
stage 25
stage 25
stage 25
stage 25
stage 25
Endocardium
Head Mesenchyme
Heart
Leg Mesenchyme
Notochord
Oral Pharynx
Pharyngeal Arches and Clefts
Somites
Wing Mesenchyme
 

Mouse

EmageMGI:102469
EurexpressMGI:102469
MGI GXDMGI:102469

Frog

Xenbase876755

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-060503-677
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona