|
MIR133C microRNA 133cGene | Official Symbol | MIR133C | Official Full Name | microRNA 133c | BirdBase ID | BB-GG14349 | CGNC ID | 59145 | also known as | MIRN133C, gga-mir-133c, microRNA mir-133c, mir-133c | gene type | miscRNA |
| Genomic Map | | Sequence Information | Genomic | | RNA | | Polypeptide | NC_006110 | Sequence Clusters/ESTs | Unigene |
| Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-133c | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TTGGTCCCCTTCAACCAGCTGC
| Comments | ubiquitous; contained in an intron of Q6IEC6_CHICK, Putative ISG12(1) protein. |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 7-10 |
 | stage 10 | | Ubiquitous
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|