|
MIR19B1 microRNA 19b-1Gene | Official Symbol | MIR19B1 | Official Full Name | microRNA 19b-1 | CGNC ID | | also known as | MIR19B, MIRN19B, gga-mir-19b, mir-19b, microRNA 19B|microRNA mir-19b, mir-19b | gene type | miscRNA |
| Genomic Map | | Sequence Information | Genomic | Genbank | RNA | | Polypeptide | | Sequence Clusters/ESTs | Unigene |
| Gene Expression | In Situ Hybridization | GEISHA | EST Profile | |
| Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-19b | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGTGCAAATCCATGCAAAACTGA
| Comments | Broadly expressed but at much reduced levels in the heart. This mIR is polycystronic with several others. |
MouseFrogFruit FlyZebra FinchZebrafish
|
|