|
OSR2 odd-skipped related transciption factor 2Gene | Official Symbol | OSR2 | Official Full Name | odd-skipped related transciption factor 2 | CGNC ID | 11962 | also known as | protein odd-skipped-related 2|odd-skipped related 2 | gene type | protein-coding |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | Osr2.Stricker.2006 | Data Source | Publication | Complete cDNA Template Probe | show ATGGGCAGCAAGGCGCTGCCGGCGCCCATCCCGCTGCACCCGTCCCTGCAGCTCACCAACTACTCCTTCCTCCAGGCCG TCAACACCTTCCCCGCGGCCGTGGACCAGCTGCAAGGGCTGTACGGGCTGAGCGCCGTGCAAACCATGCACATGAACCA CTGGACGTTGGGCTACCCCGGCGTGCACGAGATCGCCCGCTCCGCCCTCACGGAGATGGCGGCCGCGCAGGGCCTGGTG GACTCGCGCTTCCCCTTCCCCGCGCTGCCCTTCGCCGCGCACCTCTTCCACCCCAAGCAGGGCGCCGCGGCCCACGTCC TCCCGGCGCTGCACAAGGAGCGGCCCCGCTTCGACTTCGCCAACC | Citation | Stricker S, Brieske N, Haupt J, Mundlos S. Comparative expression pattern of Odd-skipped related genes Osr1 and Osr2 in chick embryonic development. Gene Expr Patterns. 2006 Oct;6(8):826-34. Epub 2006 Mar 22. | Copyright | Reprinted with permission from Elsevier. Copyright © 2006 Elsevier B.V. All rights reserved. | Comments | For cOsr2, two probes were designed based on the predicted sequence XM_418353. We amplified the 5′-coding region without the zinc-finger domain and the full-length ORF for use as probes, respectively, using the primers cOsr2-F: ATGGGCAGCAAGGCGCTGC; cOsr2-R1: GGTTGGCGAAGTCGAAGCG; and cOsr2-R2: TCAGAAGTCCTGCCGCGGGGT. Both probes were PCR amplified from 5-day whole chicken embryonic cDNA and cloned into pCRII-TOPO (Invitrogen). Both probes yielded identical results. |
MouseFrogFruit FlyZebra FinchZebrafish
|
|