| |
MIR16-1 microRNA 16-1| Gene | | Official Symbol | MIR16-1 | | Official Full Name | microRNA 16-1 | | CGNC ID | 59221 | | also known as | MIRN16-1, gga-mir-16-1, mir-16-1, microRNA mir-16-1, mir-16 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-16 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TAGCAGCACGTAAATATTGGTG
| | Comments | widespread expression (not heart) detected stages 3-24; mir-16-2 contained in gene for SMC4 structural maintenance of chromosomes 4-like 1 |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 19 |
 | | stage 19 | | Widespread Expression
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|