Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
MIR215 Gene Summary Expression Other Species Expression JBrowse Gene Official Symbol MIR215 Official Full Name microRNA 215 CGNC ID 59102 also known as MIRN215, gga-mir-215, microRNA mir-215, mir-215 gene type miscRNA
Genomic Map Sequence Information Gene Expression Orthology Entrez Gene Ensembl Gene Genetic Phenotypes MOD Fruit Fly Human Mouse Xenopus Zebrafish
Gene Ontology Molecular Function Biological Process Cellular Component
Links to other databases
GEISHA Id gga-miR-215 Data Source GEISHA ISH Analysis Complete cDNA Template Probe show ATGACCTATGAATTGACAGAC
Comments low level ubiquitous or no expression
ambiguous. This miR found on the antisense strand within gene isoleucine-tRNA synthetase 2, mitochondrial ENSGALG00000009566. Listed in error as in this gene in Darnell et al., 2006.
no images
Mouse Frog Fruit Fly Zebra Finch Zebrafish
