|
MIR128-2 microRNA 128-2Gene | Official Symbol | MIR128-2 | Official Full Name | microRNA 128-2 | CGNC ID | 59082 | also known as | MIRN128-2, gga-mir-128-2, mir-128-2, microRNA mir-128-2, mir-128 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | Entrez Gene | 777796 | Ensembl Gene | | KEGG | |
|
GEISHA Id | gga-miR-128 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TCACAGTGAACCGGTCTCTTT
| Comments | same probe as 128a or b, 128-1 and 128-2 |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|