| |
MIR128-2 microRNA 128-2| Gene | | Official Symbol | MIR128-2 | | Official Full Name | microRNA 128-2 | | CGNC ID | 59082 | | also known as | MIRN128-2, gga-mir-128-2, mir-128-2, microRNA mir-128-2, mir-128 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | | Entrez Gene | 777796 | | Ensembl Gene | | | KEGG | |
|
| GEISHA Id | gga-miR-128 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TCACAGTGAACCGGTCTCTTT
| | Comments | same probe as 128a or b, 128-1 and 128-2 |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|