| |
MIR196A1 microRNA 196a-1| Gene | | Official Symbol | MIR196A1 | | Official Full Name | microRNA 196a-1 | | CGNC ID | | | also known as | MIR196-1, MIRN196-1, MIRN196A1, gga-mir-196-1, mir-196-1, microRNA 196-1|microRNA mir-196-1, mir-196-1 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-196 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TAGGTAGTTTCATGTTGTTGG
| | Comments | stages 4-12 were negitive, stages 15-25 had potential low level surface ectoderm label (ambiguous compared to background); |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|