| |
MIR19B1 microRNA 19b-1| Gene | | Official Symbol | MIR19B1 | | Official Full Name | microRNA 19b-1 | | CGNC ID | | | also known as | MIR19B, MIRN19B, gga-mir-19b, mir-19b, microRNA 19B|microRNA mir-19b, mir-19b | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-19b | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGTGCAAATCCATGCAAAACTGA
| | Comments | Broadly expressed but at much reduced levels in the heart. This mIR is polycystronic with several others. |
MouseFrogFruit FlyZebra FinchZebrafish
|
|