|
MIR30C2 microRNA 30c-2Gene | Official Symbol | MIR30C2 | Official Full Name | microRNA 30c-2 | CGNC ID | | also known as | MIR30C-2, MIRN30C-2, gga-mir-30c-2, mir-30c-2, microRNA mir-30c-2, mir-30c-2 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-30c | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGTAAACATCCTACACTCTCAGC
| Comments | no expression detected stages 4-25.
This miR (30c-1) contained in the intron of ENSGALG00000003189 (NFYC) with mir-30e |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 13-18 |
 | stage 17 | | | 19-21 |  | stage 21 | | Widespread Expression
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|