| |
MIR7-2
microRNA 7-2| Gene | | Official Symbol | MIR7-2 | | Official Full Name | microRNA 7-2 | | CGNC ID | 59126 | | also known as | MIRN7-2, gga-mir-7-2, mir-7-2, microRNA mir-7-2, mir-7 | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-miR-7 | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show TGGAAGACTAGTGATTTTGTTG
| | Comments | one copy of this miR found in an intron of
ENSGALG00000012591 |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 25-30 |
 | | stage 25 |
 | | stage 30 |
| Atria
Unlabeled
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
