Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
17.5 Gene Summary Expression Other Species Expression JBrowse Gene Official Symbol 17.5 Official Full Name lectin-like protein; type II transmembrane protein (17.5) CGNC ID 49789 also known as 17.5 gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Entrez Gene Ensembl Gene Genetic Phenotypes MOD Fruit Fly Human Mouse Xenopus Zebrafish
Gene Ontology Molecular Function Biological Process Cellular Component
Links to other databases
GEISHA Id CDC25B.Bénazéraf.2006 Data Source Publication Forward cDNA Template Probe show CTCGGGGAGGGAGCCCTGCGTGCCGAGGCCCAGCTCTGCGCCCGACCTGCTGTTTGATACCCCCGAGAAGGAAAACCTC
Citation Bénazéraf B, Chen Q, Peco E, Lobjois V, Médevielle F, Ducommun B, Pituello F. Identification of an unexpected link between the Shh pathway and a G2/M regulator, the phosphatase CDC25B. Dev Biol. 2006 Jun 1;294(1):133-47. Epub 2006 Mar 29.
Copyright "Reprinted from Developmental Biology, 294, Bertrand Bénazérafa, Qiusheng Chena, Emilie Pecoa, Valérie Lobjoisa, François Médeviellea, Bernard Ducommunb and Fabienne Pituello, Identification of an unexpected link between the Shh pathway and a G2/M regulator, the phosphatase CDC25B, 133-147, Copyright 2006, with permission from Elsevier.
Copyright © 2006 Elsevier B.V. All rights reserved. Comments Sequence does not map to the present build of the chicken genome. Sequence matches mRNA for hypothetical protein, clone 32b15, GenBank Accession AJ720997.1, Unigene Gga.2184 Unigene homologs are CDC25B
According to the authors, "CDC25B expression patterns were analyzed in chicken embryos using the antisense digoxigenin-RNA probe prepared from the ChEST203l5 (obtained from the HGMP-RC) coding for part of the CDC25B cDNA." The sequence below was obtained from NCBI (acc# BU454373) for clone ChEST203l5.
no images
Mouse Frog Fruit Fly Zebra Finch Zebrafish
