| |
MIRLET7D
microRNA let-7d| Gene | | Official Symbol | MIRLET7D | | Official Full Name | microRNA let-7d | | CGNC ID | 59151 | | also known as | MIRNLET7D, gga-let-7d, microRNA 7D, let-7d | | gene type | miscRNA |
| | Genomic Map | | | Sequence Information | | | Gene Expression | | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | | Fruit Fly | | | | | | Human | | | | | | Mouse | | | | | | Xenopus | | | | | | Zebrafish | | | | |
| | Gene Ontology | | Molecular Function | | | Biological Process | | | Cellular Component | |
| | Links to other databases | |
| GEISHA Id | gga-let-7d | Data Source | GEISHA ISH Analysis | | Complete cDNA Template Probe | show AGAGGTAGTGGGTTGCATAGT
| | Comments | no signal detected stages 4-25 |
| Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | | 25 |
 | | stage 25 |
| Unlabeled Embryonic
|
MouseFrogFruit FlyZebra FinchZebrafish |
|
