|
MIRLET7G microRNA let-7gGene | Official Symbol | MIRLET7G | Official Full Name | microRNA let-7g | CGNC ID | | also known as | MIRNLET7G, gga-let-7g, let-7g, microRNA 7G, let-7g | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-let-7g | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGAGGTAGTAGTTTGTACAGT
| Comments | ambiguous; contained in the intron of TWF2_CHICK (twinfilin-2) ENSGALG00000003977 |
MouseFrogFruit FlyZebra FinchZebrafish
|
|