|
MIRLET7E microRNA let-7eGene | Official Symbol | MIRLET7E | Official Full Name | microRNA let-7e | CGNC ID | 59246 | also known as | MIRLET7J, MIRNLET7J, gga-let-7j, let-7j, microRNA 7J|microRNA let-7j, let-7j | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
Entry 1Entry 2GEISHA Id | gga-let-7j | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TGAGGTAGTAGGTTGTATAGTT
| Comments | identical probe sequence to let-7a |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|