|
MIR215 microRNA 215Gene | Official Symbol | MIR215 | Official Full Name | microRNA 215 | CGNC ID | 59102 | also known as | MIRN215, gga-mir-215, microRNA mir-215, mir-215 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-215 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show ATGACCTATGAATTGACAGAC
| Comments | low level ubiquitous or no expression
ambiguous. This miR found on the antisense strand within gene isoleucine-tRNA synthetase 2, mitochondrial ENSGALG00000009566. Listed in error as in this gene in Darnell et al., 2006. |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|