|
MIR222 microRNA 222Gene | Official Symbol | MIR222 | Official Full Name | microRNA 222 | CGNC ID | 59213 | also known as | MIR222-1, MIR222A, MIRN222A, gga-mir-222, gga-mir-222-1, gga-mir-222a, gga-mir-222b, mir-222a, microRNA 222A|microRNA mir-222|microRNA mir-222-1|microRNA mir-222a | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-222a | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show AGCTACATCTGGCTACTGGGTCTC
| Comments | no specific expression detected, ambiguous; there are 2 mir-222a genes near each other, and near mir-221 in the chick genome |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 13-15 |
 | stage 15 | | Unlabeled
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|