|
MIR26A1 microRNA 26a-1Gene | Official Symbol | MIR26A1 | Official Full Name | microRNA 26a-1 | CGNC ID | 60559 | also known as | MIR26A, MIRN26A, gga-mir-26a, mir-26a, microRNA 26A|microRNA mir-26a, mir-26a | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | Entrez Gene | 777941 | Ensembl Gene | | KEGG | |
|
GEISHA Id | gga-miR-26a | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TTCAAGTAATCCAGGATAGGC
| Comments | ubiquitous; found in an intron of CTDSL_CHICK, CTD small phosphatase-like protein |
Stage | Image (click image to view full size) | Location (click to highlight) | Comments (click to highlight) | 25 |
 | stage 25 | | Widespread Expression
|
MouseFrogFruit FlyZebra FinchZebrafish
|
|