|
MIR27B microRNA 27bGene | Official Symbol | MIR27B | Official Full Name | microRNA 27b | CGNC ID | 59167 | also known as | MIRN27B, gga-mir-27b, mir-27b, microRNA mir-27b, mir-27b | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-27b | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TTCACAGTGGCTAAGTTCTGC
| Comments | no specific expression detected; Located in intron of ENSGALG00000012615 Q5ZK89_CHICK, which also contains mir-23b and mir-24 |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|