|
MIR32 microRNA 32Gene | Official Symbol | MIR32 | Official Full Name | microRNA 32 | CGNC ID | 59091 | also known as | MIRN32, gga-mir-32, mir-32, microRNA mir-32, mir-32 | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | Entrez Gene | 777798 | Ensembl Gene | | KEGG | |
|
GEISHA Id | gga-miR-32 | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show TATTGCACATTACTAAGTTGC
| Comments | no expression detected
this miR located on the sense strand within the gene for Protein C9orf5 (Protein CG-2). ENSGALG00000013138 |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|