 |
|
 |
 |
 |
Quick Search |
|
|
|
|
 |
|
|
 |
Gene Family QuickSearch |
|
|
 |
Human Disease Gene Search |
|
 |
 |
|
 |
 |
|
 |
|
MIR23B microRNA 23bGene | Official Symbol | MIR23B | Official Full Name | microRNA 23b | CGNC ID | 59164 | also known as | MIRN23B, gga-mir-23b, mir-23b, microRNA mir-23b, mir-23b | gene type | miscRNA |
| Genomic Map | | Sequence Information | | Gene Expression | | Orthology | | Entrez Gene | Ensembl Gene | Genetic Phenotypes | MOD | Fruit Fly | | | | | Human | | | | | Mouse | | | | | Xenopus | | | | | Zebrafish | | | | |
| Gene Ontology | Molecular Function | | Biological Process | | Cellular Component | |
| Links to other databases | |
GEISHA Id | gga-miR-23b | Data Source | GEISHA ISH Analysis | Complete cDNA Template Probe | show ATCACATTGCCAGGGATTACC
| Comments | no specific label detected; found in gene Q5ZK89_CHICK Aminopeptidase O along with mir-24 and -27b |
no images
MouseFrogFruit FlyZebra FinchZebrafish
|
|