Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
EPHB1 Gene Summary Expression Other Species Expression JBrowse Gene Official Symbol EPHB1 Official Full Name EPH receptor B1 CGNC ID 4986 also known as CEK6, EK6, ephrin type-B receptor 1|EPH-like kinase 6|tyrosine-protein kinase receptor EPH-2, Tyrosine-protein kinase receptor EPH-2, NET, HEK6, ELK, Ephrin type-B receptor 1 precursor gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function ATP binding , transmembrane-ephrin receptor activity Biological Process axon guidance , cell chemotaxis , cell-substrate adhesion , dendritic spine development , more... dendritic spine morphogenesis , ephrin receptor signaling pathway , establishment of cell polarity , positive regulation of synapse assembly , protein autophosphorylation , regulation of ERK1 and ERK2 cascade , regulation of JNK cascade Cellular Component dendrite , early endosome membrane , integral component of plasma membrane
Links to other databases
GEISHA Id EPHB1.Santiago.2002 Data Source Publication Complete cDNA Template Probe show TCCCGCGGCTCCGCTCGGCGCGGCCCGGCCCGGCCCGGCTGCCTCCCGCCGCCCATGCCCTCCCGCCGGCGGCGGCTGA
Citation Santiago A, Ericsson CA. Ephrin-B ligands play a dual role in the control of neural crest cell migration. 2002 Aug;129(15):3621-32 Copyright Great Britain © The Company of Biologists Limited 2002 Comments Insufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (Acc. # XM_015277145.2).
Mouse Frog Fruit Fly Zebra Finch Zebrafish
