GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

HOXB4
homeobox B4

Gene
Official SymbolHOXB4
Official Full Namehomeobox B4
CGNC ID15553
also known asChox-Z, homeobox protein Hox-B4|homeo box B4|homeobox protein Hox-Z
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
GenomicGenbank
RNANM_205293
PolypeptideNP_990624
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.39784
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human3214MIM:142965
Mouse15412All phenotypic alleles (8):Targeted, knock-out(6) Targeted, other(2) MGI:96185
Xenopus548393, 7347961033881
Zebrafish30340ENSDARG00000013533ZDB-GENE-990415-105ZFIN:ZDB-GENE-990415-105
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene396230
Ensembl Gene
KEGGgga:396230

Entry 1

GEISHA IdHOXB4.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGGAAAACGAGTAAAGGGGGGGAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGAGAGGCACAGAGAATGGGCGcDNA Template Length656
Forward cDNA Template Probeshow
NAAGGCGCAGAGGCGATTGACCTCGCCTCGGGTGAATACGGTTATAGTGGAATTCCTTCTCCAGCTCCAGGACCTGCTG
CCTGGTGTAGGCTGTGCGCGAGCGTTTCGGTTCCCCTCCTGAATAATTGGGGTTTACCGTGCTTACATGGACTTTTTTC
ATCCAGGGGTAAACTACCGGCTCTTTGCAAGAGGAATTGGAAGGGCTTTGGTTCAAAGAGTTTTGGCTGCAGGAGGGTG
GAGGGCTGGGGGTGCCCGGCTCGCAGGGATGGTTTGGCTCAAAGAGATGGCTCTGCAGTCCGGCCGGAGGATGGACATG
ACCCCGGGGGGATAACACCGCTGCTTGGTGCCCGGAGCTCTGACAGGACGGGTAGAGCTGCTCGCTGCATGCTGACCGC
GGCTGGTACATCGCTTCATGTTGGAAAGTGCTCTCTCGCCTCTGGCTGCTGTAATATTCCGGCGAGTGATTGGGAAGGT
AATCGCTGTGGGAATACTCTTCACAGGGTGGGAACTTGGGGTCCACATAGTTGGAGTTGATCAAAAACGAGCTCATGGC
CATTAATTTCTTAGAATTGCACACACGAAAAATATATATATATATATATTTCCTAAAATTTATTCCTGTCCCCCCCTAT
AATCGATTTACAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Primitive Streak
 
4-6
stage 4
stage 6
Early Mesoderm
Primitive Streak
 
7-12
stage 7
stage 9
stage 10
stage 12
Intermediate Mesoderm
Lateral Plate Mesoderm
Paraxial Mesoderm
Primitive Streak
Somites
Spinal Cord
 
13-18
stage 13
stage 14
stage 18
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
Somites
Spinal Cord
Tail
Widespread Expression
 
19-24
stage 19
stage 20
stage 22
Hindbrain
Intermediate Mesoderm
Limb Buds
Paraxial Mesoderm
Somatic Mesoderm
Somites
Spinal Cord
Tail
 
25
stage 25
stage 25
Hindbrain
Midgut
Somatic Mesoderm
Somites
Spinal Cord
Tail
Wing
 

Entry 2

GEISHA IdHOXB4.Reid.2002Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205293).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 26
stage 30
stage 30
stage 30
Dermis
Feathers/Scutae
Hindbrain
Somites
Spinal Cord
Surface Ectoderm
Vertebrae
 
31-44
stage 35
stage 44
stage 44
Feathers/Scutae
Surface Ectoderm
Comparison of several genes

Entry 3

GEISHA IdHoxb-4.Gaunt.2000Data SourcePublication
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CitationGaunt SJ. Evolutionary shifts of vertebrate structures and Hox expression up and down the axial series of segments: a consideration of possible mechanisms. Int J Dev Biol. 2000
CopyrightCopyright © 2007 UBC Press
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205293.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Primitive Streak
 
7-12
stage 8
stage 9
stage 12
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Spinal Cord
 

Entry 4

GEISHA IdHOXB4.Hughes.2011Data SourcePublication
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CitationHughes MW, Wu P, Jiang TX, Lin SJ, Dong CY, Li A, Hsieh FJ, Widelitz RB, Chuong CM. In search of the Golden Fleece: unraveling principles of morphogenesis by studying the integrative biology of skin appendages Integr Biol (Camb). 2011 Apr;3(4):388-407. Epub 2011 Mar 24.
Copyright© Royal Society of Chemistry 2011
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205293.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-29
stage 26
stage 26
stage 29
Dermis
Limb Buds
epithelium

Entry 5

GEISHA IdHOXB4.Barak.2012Data SourcePublication
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
Citation Barak H, Preger-Ben Noon E, Reshef R. Comparative spatiotemporal analysis of Hox gene expression in early stages of intermediate mesoderm formation. Dev Dyn. 2012 Oct;241(10):1637-49.
CopyrightCopyright © 2012 Wiley Periodicals, Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205293.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 5
stage 5
Lateral Plate Mesoderm
Primitive Streak
 
7-11
stage 7
stage 7
stage 8
stage 8
stage 9
stage 9
stage 10
stage 10
stage 11
stage 11
Central Nervous System
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somatic Mesoderm
 

Entry 6

GEISHA IdHoxb-4.Itasaki.1996Data SourcePublication
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CitationItasaki N, Sharpe J, Morrison A, Krumlauf R. Reprogramming Hox expression in the vertebrate hindbrain: influence of paraxial mesoderm and rhombomere transposition. Neuron. 1996 Mar;16(3):487-500.
CopyrightCopyright © 1996 Cell Press.
CommentsComplete cDNA template sequence was obtained from information referenced in the publication as described in Itasaki et al. 1996.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 19
Ear/Otic Placode
Rhombomeres
Somites
control chick embryo
31-44
stage 44
  

Entry 7

GEISHA IdHoxb‐4.Gaunt.1996Data SourcePublication
Complete cDNA Template Probeshow
CGGAATATTACAGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGA
GCAGCTCTACCCGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCC
GGACTGCAGAGCCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAA
ACTCTCTGAACCAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAG
CACGGTAAACCCCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTG
GAGAAGGAATTCCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGC
GCCAGATCAAAATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTC
CAACCCTTCCAGCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAG
CitationGaunt SJ, Strachan L. Temporal colinearity in expression of anterior Hox genes in developing chick embryos. Dev Dyn. 1996 Nov;207(3):270-80.
CopyrightCopyright © 1996 Wiley‐Liss, Inc.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Gaunt et al. 1996.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 5
stage 5
Primitive Streak
 
7-12
stage 8
stage 9
stage 9
stage 9
stage 12
stage 12
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
Somites
 
31-44
stage 44
stage 44
stage 44
  

Entry 8

GEISHA IdHoxb4.Moreau.2019Data SourcePublication
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CitationChloe Moreau, Paolo Caldarelli, Didier Rocancourt, Julian Roussel, Nicolas Denans, Olivier Pourquie, Jerome Gros. Timed Collinear Activation of Hox Genes during Gastrulation Controls the Avian Forelimb Position. Curr Biol. 2019 Jan 7; 29(1):35-50.e4. Epub 2018 Dec 13. DOI: 10.1016/j.cub.2018.11.009.
CopyrightCopyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205293.1).
no images

Entry 9

GEISHA IdHOXB4.Olivera-Martinez.2014Data SourcePublication
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CitationIsabel Olivera-Martinez, Nick Schurch, Roman A Li, Junfang Song, Pamela A Halley, Raman M Das, Dave W Burt, Geoffrey J Barton, Kate G Storey. Major transcriptome re-organisation and abrupt changes in signalling, cell cycle and chromatin regulation at neural differentiation in vivo. Development 2014 Aug;141(16):3266-76. Epub 2014 Jul 25. DOI: 10.1242/dev.112623.
CopyrightCopyright © 2014. Published by The Company of Biologists Ltd.
CommentsAuthors indicated the probe was made from gene construct provided by R. Krumlauf. As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205293.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
Lateral Plate Mesoderm
Neural Plate/Tube
Somites
 
all
 
  

Entry 10

GEISHA IdHoxb4.Iimura.2006Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CitationTadahiro Iimura, Olivier Pourquié. Collinear activation of Hoxb genes during gastrulation is linked to mesoderm cell ingression. Nature. 2006 Aug 3;442(7102):568-71. Epub 2006 Jun 7. DOI: 10.1038/nature04838.
CopyrightCopyright © 2006 Nature Publishing Group.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205293.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Early Mesoderm
Primitive Streak
 

Entry 11

GEISHA IdHoxb4.Bel-Vialar.2002Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCGGTGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGGAGGATTTCAGGGCCCGTTGTCGTATGGCAGTGCCGGAGGTGGGGGTGAATTTTTGCTGCTGCAAATCTCCGCA
GACCGTCTGTTGGGGAAAAAGCACCCGGAGTTCGACCAGAATCTTCAGGGGAAATAATAATACTAATAAT
CitationSophie Bel-Vialar, Nobue Itasaki, Robb Krumlauf. Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 2002 Nov;129(22):5103-15.
CopyrightCopyright © The Company of Biologists Limited 2002.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205293.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
Primitive Streak
 
7-12
stage 8
stage 9
stage 10
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somites
 
13-15
stage 14
stage 14
stage 15
Intermediate Mesoderm
Lateral Plate Mesoderm
Somites
Spinal Cord
 

Entry 12

GEISHA IdHOXB4.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
GCGGGGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGCTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGTATGGACGGGGTGTGCGTGCTCGTGGGTGTGATTGTGAGTGTGAGTGTGTGTAGGGAACACGGGAGAATAGTGG
GGTTTTTTTAATGCTCCGAGAAGCGAAGGAAGGAGGGGGGCTTTTTTTATTTATAAGGGGCAACAGGGAGAGGCTCAGC
TCCAACAAAGCAGAGCCGTGCTGCTGTGCCCCTCTTCCATTAGAAGAAGGCTGTAGGTAGTAGTTTTCAGATTTGGCTA
AGATGGATCCTTGTTTCATCTTTAATCACGCCAAGCTCTGCCCCATTTGTCATGTTTACTCTCCCGTACAAAGGATGGA
CCTTATGTCTGCTATTACCTCGACAACCAGCGTTCACTTTAATAAATGAGGCTCAGTTTCT
CommentsImages provided by Claire Anderson. The probe was kindly supplied by R. Krumlauf. As insufficient information was provided to verify sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205293.2). Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Amnion
Anterior Intestinal Portal
Atria
Blood Islands
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Crest
Neural Plate/Tube
Notochord
Sinus Venosus
Somites
Ventricles
HH12-

Entry 13

GEISHA IdHOXB4.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GCGGGGCCCGGGGAACGGGGCCGGAGGGGAGCGGGCGCCCCCGGCCGCCTCCCCGGGGATGCTCCGGGCCCCGGGAGAG
CCCGTGCCGGGCAGATTTCCTTATCCGGGGATCGCAGGCCACCTCGCCATTGGCCCGCGCTGTCACATGGACTCCAACT
TTGTTCACTTGACAGTAAGTAGGAGGGTTTCACGAAACAGGAAAACGAGTAAAGGGGGGGACAGGAATAAATTTTAGGA
AATATATATATATATATATTTTTCGTGTGTGCAATTCTAAGAAATTAATGGCCATGAGCTCGTTTTTGATCAACTCCAA
CTATGTGGACCCCAAGTTCCCACCCTGTGAAGAGTATTCCCACAGCGATTACCTTCCCAATCACTCGCCGGAATATTAC
AGCAGCCAGAGGCGAGAGAGCACTTTCCAACATGAAGCGATGTACCAGCCGCGGTCAGCATGCAGCGAGCAGCTCTACC
CGTCCTGTCAGAGCTCCGGGCACCAAGCAGCGGTGTTATCCCCCCGGGGTCATGTCCATCCTCCGGCCGGACTGCAGAG
CCATCTCTCTGAGCCAAACCATCCCTGCGAGCCGGGCACCCCCAGCCCTCCACCCTCCTGCAGCCAAAACTCTCTGAAC
CAAAGCCCTTCCAATTCCTCTTGCAAAGAGCCGGTAGTTTACCCCTGGATGAAAAAAGTCCATGTAAGCACGGTAAACC
CCAATTATTCAGGAGGGGAACCGAAACGTTCGCGCACAGCCTACACCAGGCAGCAGGTCCTGGAGCTGGAGAAGGAATT
CCACTATAACCGCTATCTCACCCGGAGGCGGAGGGTCGAAATCGCCCATTCTCTGTGCCTCTCCGAGCGCCAGATCAAA
ATCTGGTTCCAGAACAGGAGGATGAAATGGAAGAAAGACCACAAGTTACCCAACACCAAGATCAGGTCCAACCCTTCCA
GCTCCTCCGCCAGCCTGCAGATCCCACCGGCAGCTTCTCAAAGCCGATCCAGCGGACCAGCCAGCAGCCTATAACTATT
CCCTGTATGGACGGGGTGTGCGTGCTCGTGGGTGTGATTGTGAGTGTGAGTGTGTGTAGGGAACACGGGAGAATAGTGG
GGTTTTTTTAATGCTCCGAGAAGCGAAGGAAGGAGGGGGGCTTTTTTTATTTATAAGGGGCAACAGGGAGAGGCTCAGC
TCCAACAAAGCAGAGCCGTGCTGCTGTGCCCCTCTTCCATTAGAAGAAGGCTGTAGGTAGTAGTTTTCAGATTTGGCTA
AGATGGATCCTTGTTTCATCTTTAATCACGCCAAGCTCTGCCCCATTTGTCATGTTTACTCTCCCGTACAAAGGATGGA
CCTTATGTCTGCTATTACCTCGACAACCAGCGTTCACTTTAATAAATGAGGCTCAGTTTCT
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI ( NM_205293.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Proepicardium
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.39784

Mouse

EmageMGI:96185
EurexpressMGI:96185
MGI GXDMGI:96185

Frog

Xenbase1033881

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-990415-105
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona