GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

NPPA
natriuretic peptide A

Gene
Official SymbolNPPA
Official Full Namenatriuretic peptide A
CGNC ID49466
also known asANF, ANP, NPPB, natriuretic peptides B|atrial natriuretic factor|atrial natriuretic peptide|natriuretic peptide B|natriuretic peptide precursor A|natriuretic peptides A|prepronatriodilatin, Prepronatriodilatin, BNF , Atrial natriuretic peptide
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204925
PolypeptideNP_990256
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.5157
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Functionhormone activity
Biological ProcesscGMP biosynthetic process, embryo development ending in birth or egg hatching, more...receptor guanylyl cyclase signaling pathway, regulation of blood vessel size
Cellular Componentextracellular region
Links to other databases
Entrez Gene395765
Ensembl Gene
KEGGgga:395765

Entry 1

GEISHA IdBNF.Houweling.2005Data SourcePublication
Complete cDNA Template Probeshow
TGAAGAGTCATCTCAGAAGAAACAGCTTGAACTTCCCCTATTCCCAACGAACCCAGCGCCATGGACACTAGAGGTTCAT
TTTCCTGTGGTTTCCTCTTGCTGCTTCTCATCCAGCTGCAGCCCAGCAGAGCCAACCCCATCTACAACCTCAGCCCTGC
CAAAGAACTGGCCAGCATGGAGGCTCTTCTGGAGAGACTGGAGGATAAGTTTGCACTGATTGAAGCCCTGGAGTCCAAT
CCTGACCTGCAAGAGCCTCAAACCCAAGAGGAGATCCCACCAGAACTCACAGATGACAGCGATGAGCAGAAGGCTGAAC
CCAAGCTAGCATCCAACACTCCTCTGTCCTACAGGAACCCCTTCCTCAAGAGACTGAGGGGGGTGCAGATGCCCAGGAT
GATGAGAGATTCTGGCTGCTTCGGCAGAAGAATTGATAGGATTGGCTCCTTGAGTGGAATGGGTTGCAATGGTTCCAGG
AAGAATTAGGACCACTTCCCGACCCGTGCTCTGAAGAATGCTTCACAGAACCTGATCCTCCCAAGGCAAAAGCCAGACG
CTTCCTAAACTCATCAACAGAAAGTTATTCCTATTTTTATTTATTTATTTATTTATTTATTTGAGCTCTCTGTCTCTCT
CTTTTTCTTAATAACATTTCTTACTCTAGCACCGTGAGAACATCTTTAAATAAAACTAACACGATAGATATCTATGCTG
GACCTCTCTCCTGTCTGTTGCATTAAAATTTCTTGTATTTTCCT
CitationHouweling AC, Somi S, Massink MP, Groenen MA, Moorman AF, Christoffels VM. Comparative analysis of the natriuretic peptide precursor gene cluster in vertebrates reveals loss of ANF and retention of CNP-3 in chicken. Dev Dyn. 2005 Jul;233(3):1076-82.
CopyrightWiley-Liss, Inc. 2005
CommentsInsufficient information provided to verify exact probe sequence. Sequence provided is entire coding region from Accession # NM_204925 (since according to this paper ANF = BNF in chick).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 28
Atria
Ventricles
 
31-44
stage 33
stage 36
stage 36
stage 44
Atria
Spinal Ganglia and Nerves
Unlabeled
Ventricles
 

Entry 2

GEISHA IdANF.Houweling.2002Data SourcePublication
Complete cDNA Template Probeshow
AACTTCCCCTATTCCCAACGAACCCAGCGCCATGGACACTAGAGGTTCATTTTCCTGTGGTTTCCTCTTGCTGCTTCTC
ATCCAGCTGCAGCCCAGCAGAGCCAACCCCATCTACAACCTCAGCCCTGCCAAAGAACTGGCCAGCATGGAGGCTCTTC
TGGAGAGACTGGAGGATAAGTTTGCACTGATTGAAGCCCTGGAGTCCAATCCTGACCTGCAAGAGCCTCAAACCCAAGA
GGAGATCCCACCAGAACTCACAGATGACAGCGATGAGCAGAAGGCTGAACCCAAGCTAGCATCCAACACTCCTCTGTCC
TACAGGAACCCCTTCCTCAAGAGACTGAGGGGGGTGCAGATGCCCAGGATGATGAGAGATTCTGGCTGCTTCGGCAGAA
GAATTGATAGGATTGGCTCCTTGAGTGGAATGGGTTGCAATGGTTCCAGGAAGAATTAGGACCACTTCCCGACCCGTGC
TCTGAAGAATGCTTCACAGAACCTGATCCTCCCAAGGCAAAAGCCAGACGCTTCCTAAACTCATCAACAGAAAGTTATT
CCTATTTTTATTTATTTATTTATTTATTTATTTGAGCTCTCTGTCTCTCTCTTTTTCTTAATAACATTTCTTACTCTAG
CACCGTGAGAACATCTTTAAATAAAACTAACACGATAGATATCTATGCTGGACCTCTCTCCTGTCT
CitationHouweling AC, Somi S, Van Den Hoff MJ, Moorman AF, Christoffels VM. Developmental pattern of ANF gene expression reveals a strict localization of cardiac chamber formation in chicken. Anat Rec. 2002 Feb 1;266(2):93-102.
CopyrightCopyright © 1999–2012 John Wiley & Sons, Inc. All Rights Reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 9
stage 9
stage 9
stage 9
stage 9
stage 9
stage 9
Lateral Plate Mesoderm
Myocardium
HH Stage 9+
HH Stage 9-
19-24
stage 21
stage 21
stage 22
stage 22
stage 24
stage 24
stage 24
Heart
Myocardium
Outflow Tract
Ventricles
 
25-30
stage 28
stage 28
stage 28
stage 28
stage 30
stage 30
stage 30
Atria
Heart
Myocardium
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.5157

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona