GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ANXA2
annexin A2

Gene
Official SymbolANXA2
Official Full Nameannexin A2
CGNC ID49740
also known asANXA2P2, annexin A2|PAP-IV|annexin A2 pseudogene 2|annexin II|annexin-2|calpactin I heavy chain|calpactin-1 heavy chain|chromobindin-8|lipocortin II|p36|placental anticoagulant protein IV|protein I
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205351
PolypeptideNP_990682
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3641
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human302ENSG00000182718MIM:151740
Mouse12306ENSMUSG00000032231All phenotypic alleles (3):Targeted, knock-out(1) Targeted, other(2) MGI:88246
Xenopus394517, 397735, 397754945314
Zebrafish325557, 799806ENSDARG00000003216, ENSDARG00000053625ZDB-GENE-030131-4282, ZDB-GENE-030131-1089ZFIN:ZDB-GENE-030131-4282, ZFIN:ZDB-GENE-030131-1089
Gene Ontology
Molecular Functioncalcium-dependent phospholipid binding, calcium ion binding, cytoskeletal protein binding, more...phospholipase inhibitor activity
Biological Processpositive regulation of vesicle fusion
Cellular Componentbasement membrane, extracellular vesicular exosome, lipid particle, midbody, myelin sheath adaxonal region, more...Schmidt-Lanterman incisure
Links to other databases
Entrez Gene396297
Ensembl GeneENSGALG00000003770
KEGGgga:396297

Entry 1

GEISHA IdANXA2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCAAGGGCAAAAGGTGTGAAGATAC
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGTGGGGAATGTTAGTTTCTCTGGCcDNA Template Length724
Forward cDNA Template Probeshow
GCTGGTTAGGAAGTTTGGCAGAACCAAGCAGAGCGCTGCTGCTGAAGAAGTGCAGGCAGCACCAGAAGCACACGGCGTC
GGTGGTGTGGCAGGTATTGGGGCAGGGAAGGGTTTGCATGGCGGCTCGATTTTGTCGGGGGTTGCAGTAAAACGAAGAG
CAGAATAGGCATGTCTCTGCGTTTCCATTTCCCACATCACAGCTTTCAGTCCTCTCCACCACACAGGTTCAGCAGCGCC
CTCTGGTAATCACCTTTTGTGTCTTGCTGGATGAAATAATAGAGGGATTTTCCGTATTTCCTCTTGAATTCACTCTTAA
TTTTCAGCATGTCAACCTCACAGCGGGAGACCATAATCCTAATCAGGACCTTGTCACGGGTTCCCTTGCCCTTCATGGA
ATCATAGAGTCTGTCTGCAAAGTATAGCTGCTTGTTCTGAATGCACTGAACAAGATTAAGGAAGGCATTCTCCAGATCT
CCCTTAACTTCCTTCTTGATGCTCTCCAACATATCATATGGGCTGTAGCTCTTGTACCTTTCAAACACTTTCTGCAGAT
GTGGAACACTTCTTTCAGTCATAATGTTGATCCACTTGGGAACATCTGTTCCCTTTCTCTTGACACCAGCATCATAGAG
CTCCCTAGCGTCTTGGTCAATCAGTTCATAGTCAATCACAGAAGTATCTTCACACCTTTNGGCCCTTG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
Area Opaca
 
7-12
stage 9
stage 10
stage 10
stage 10
stage 10
stage 10
Amnion
Ectoderm
Notochord
extraembryonic ectoderm
 
19-24
stage 19
stage 19
stage 19
stage 19
stage 19
stage 21
Allantois
Amnion
Aorta
Ectoderm
Endoderm
Eye
Foregut
Head Mesenchyme
Hindgut
Liver
Notochord
Pharyngeal Arches and Clefts
Yolk Sack or Stalk
dorsal mesentery, ventral body wall
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
Allantois
Aorta
Atria
Ectoderm
Extraembryonic
Foregut
Head Mesenchyme
Heart
Hindbrain
Hindgut
Leg Ectoderm
Liver
Lung
Midbrain
Nasal Placode/Nerve
Notochord
Oral Pharynx
Outflow Tract
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
Wing Ectoderm
Wing Mesenchyme
Yolk Sack or Stalk
dorsal mesentery

Entry 2

GEISHA IdANXA2.Krishnan.2004Data SourcePublication
Complete cDNA Template Probeshow
CCCGCCGCCAGAGCAGCCTTGCCCGCCCCGGCCAGCATTCTGCCAACATGTCTACTGTCCATGAAATTTTAAGCAAGCT
CAGTCTGGAAGGAGATCATTCTCTCCCTCCAAGTGCATATGCCACAGTTAAGGCTTACTCAAACTTTGATGCTGACCGG
GATGCTGCAGCCCTGGAAGCAGCCATCAAGACCAAAGGTGTGGATGAAGTTACCATCATCAACATCCTGACAAACCGCA
GCAATGAACAGAGGCAGGATATTGCCTTTGCCTATCAGAGGAGAACCAAAAAGGAACTTTCTGCAGCACTTAAGTCTGC
TCTGTCAGGTCATTTAGAGGCAGTGATCTTGGGCTTGCTGAAGACACCATCACAGTATGATGCGTCTGAACTGAAAGCT
GCCATGAAGGGCCTGGGAACTGATGAAGACACACTTATCGAAATCATTTGCTCACGGACAAATCAGGAGCTTAATGAAA
TTAATAGAGTCTATAGGGAAATGTACAAAACAGAACTGGAAAAGGACATTATATCAGACACATCTGGTGACTTCCGCAA
GCTAATGGTTGCCCTGGCCAAGGGCAAAAGGTGTGAAGATACTTCTGTGATTGACTATGAACTGATTGACCAAGACGCT
AGGGAGCTCTATGATGCTGGTGTCAAGAGAAAGGGAACAGATGTTCCCAAGTGGATCAACATTATGACTGAAAGAAGTG
TTCCACATCTGCAGAAAGTGTTTGAAAGGTACAAGAGCTACAGCCCATATGATATGTTGGAGAGCATCAAGAAGGAAGT
TAAGGGAGATCTGGAGAATGCCTTCCTTAATCTTGTTCAGTGCATTCAGAACAAGCAGCTATACTTTGCAGACAGACTC
TATGATTCCATGAAGGGCAAGGGAACCCGTGACAAGGTCCTGATTAGGATTATGGTCTCCCGCTGTGAGGTTGACATGC
TGAAAATTAAGAGTGAATTCAAGAGGAAATACGGAAAATCCCTCTATTATTTCATCCAGCAAGACACAAAAGGTGATTA
CCAGAGGGCGCTGCTGAACCTGTGTGGTGGAGAGGACTGAAAGCTGTGATGTGGGAAATGGAAACGCAGAGACATGCCT
ATCTGCTCTTCGTTTTACTCCAACCCCCGACAAAATCGAGCCGCCATGCAAACCCTTCCCTGCCCCAATACCTGCCACA
CCACCGACGCCGTGTGCTTCTGGTGCTGCCTGCACTTCTCAGCAGCAGCGCTCTGCTTGGTTCTGCCAAACTTCCTAAC
AGCGTAAAGCCAGAGAAACTAACATTCCCCAGAGATAAAGGTTAAACGTGCTTGTTGAGGATGCCTCCTTGTGTAATGT
TTCTAATAAAACATAAATAAAACA
CitationKrishnan S, Deora AB, Annes JP, Osoria J, Rifkin DB, Hajjar KA. (2004) Annexin II-mediated plasmin generation activates TGF-beta3 during epithelial-mesenchymal transformation in the developing avian heart. Dev Biol. 2004 Jan 1;265(1):140-54.
CopyrightCopyright © 2003 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205351).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-15
stage 15
Endocardium
Heart
Notochord
 

Entry 3

GEISHA IdANXA2.Anderson.2020Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
ACCCGTATACATCACTATAGGGCATCGTTTACACCGCGGGGCGGCGCGGTGCATTCACAAAACAGAACTGGAAAAGGAC
ATTATATCAGACACATCTGGTGACTTCCGCAAGCTAATGGTTGCCCTGGCCAAGGGCAAAAGGTGTGAAGATACTTCTG
TGATTGACTATGAACTGATTGACCAAGACGCTAGGGAGCTCTATGATGCTGGTGTCAAGAGAAAGGGAACAGATGTTCC
CAAGTGGATCAACATTATGACTGAAAGAAGTGTTCCACATCTGCAGAAAGTGTTTGAAAGGTACAAGAGCTACAGCCCA
TATGATATGTTGGAGAGCATCAAGAAGGAAGTTAAGGGAGATCTGGAGAATGCCTTCCTTAATCTTGTTCAGTGCATTC
AGAACAAGCAGCTATACTTTGCAGACAGACTCTATGATTCCATGAAGGGCAAGGGAACCCGTGACAAGGTCCTGATTAG
GATTATGGTCTCCCGCTGTGAGGTTGACATGCTGAAAATTAAGAGTGAATTCAAGAGGAAATACGGAAAATCCCTCTAT
TATTTCATCCAGCAAGACACAAAAGGTGATTACCAGAGGGCGCTGCTGAACCTGTGTGGTGGAGAGGACTGAAAGCTGT
GATGTGGGAAATGGAAACGCAGAGACATGCCTATTCTGCTCTTCGTTTTACTGCAACCCCCGACAAAATCGAGCCGCCA
TGCAAAACCCTTCCCTGCCCCAATACCTGCCACACCACCGACGCCGTGTGCTTCTGGTGCTGCCTGCACTTCTCAGCAG
CAGCGCTCTGCTTGGTTCTGCCAAACTTCCTAACAGGCGTAAAGCCAGAGAAACTAACATTCCCCAGAGATTAACGGTT
AAACGTGCTTTGTTGAGGAATGCCTCCCTTGGTGTAATGTTTCTAATAAAACATTAATAAACCGATGTATCTCTCTCAA
AAA
CommentsImages Provided by Claire Anderson; Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Area Opaca
Ectoderm
Lateral Plate Mesoderm
Notochord
Primitive Streak
Proepicardium
Somites
Splanchnic Mesoderm
extraembryonic endoderm
extraembryonic mesoderm
 

Entry 4

GEISHA IdANXA2.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
ACCCGTATACATCACTATAGGGCATCGTTTACACCGCGGGGCGGCGCGGTGCATTCACAAAACAGAACTGGAAAAGGAC
ATTATATCAGACACATCTGGTGACTTCCGCAAGCTAATGGTTGCCCTGGCCAAGGGCAAAAGGTGTGAAGATACTTCTG
TGATTGACTATGAACTGATTGACCAAGACGCTAGGGAGCTCTATGATGCTGGTGTCAAGAGAAAGGGAACAGATGTTCC
CAAGTGGATCAACATTATGACTGAAAGAAGTGTTCCACATCTGCAGAAAGTGTTTGAAAGGTACAAGAGCTACAGCCCA
TATGATATGTTGGAGAGCATCAAGAAGGAAGTTAAGGGAGATCTGGAGAATGCCTTCCTTAATCTTGTTCAGTGCATTC
AGAACAAGCAGCTATACTTTGCAGACAGACTCTATGATTCCATGAAGGGCAAGGGAACCCGTGACAAGGTCCTGATTAG
GATTATGGTCTCCCGCTGTGAGGTTGACATGCTGAAAATTAAGAGTGAATTCAAGAGGAAATACGGAAAATCCCTCTAT
TATTTCATCCAGCAAGACACAAAAGGTGATTACCAGAGGGCGCTGCTGAACCTGTGTGGTGGAGAGGACTGAAAGCTGT
GATGTGGGAAATGGAAACGCAGAGACATGCCTATTCTGCTCTTCGTTTTACTGCAACCCCCGACAAAATCGAGCCGCCA
TGCAAAACCCTTCCCTGCCCCAATACCTGCCACACCACCGACGCCGTGTGCTTCTGGTGCTGCCTGCACTTCTCAGCAG
CAGCGCTCTGCTTGGTTCTGCCAAACTTCCTAACAGGCGTAAAGCCAGAGAAACTAACATTCCCCAGAGATTAACGGTT
AAACGTGCTTTGTTGAGGAATGCCTCCCTTGGTGTAATGTTTCTAATAAAACATTAATAAACCGATGTATCTCTCTCAA
AAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Proepicardium
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3641

Mouse

EmageMGI:88246
EurexpressMGI:88246
MGI GXDMGI:88246

Frog

Xenbase945314

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-4282, ZDB-GENE-030131-1089
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona