GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TFAP2C
transcription factor AP-2 gamma

Gene
Official SymbolTFAP2C
Official Full Nametranscription factor AP-2 gamma
CGNC ID5810
also known astranscription factor AP-2 gamma|transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_417497
PolypeptideXP_417497
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human7022ENSG00000087510MIM:601602
Mouse21420ENSMUSG00000028640All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:106032
Xenopus496506, 398790488670
Zebrafish494033ENSDARG00000040606ZDB-GENE-041212-61ZFIN:ZDB-GENE-041212-61
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene419327
Ensembl Gene
KEGGgga:419327

Entry 1

GEISHA IdAP2gamma.Li.2008Data SourcePublication
Complete cDNA Template Probeshow
ATGTTGTGGAAACTGGCAGATAACGTCAAGTACGAGGAGGACTGCGAGGACCGCCACGATGGGAGCAGCAACGGGAACC
CGCGGCTCCCGCACCTCTCGGCGGTCAGCCAGCACCTGTACAGCCCGGCCCCGCCGCTCTCCCACTCCGGAGCCTCCGA
CTTCCAGCCTCCTTACTTCCCCCCCCCTTACCAGCCGCTGCCTTACTCCCAATCCAGCGACCCCTACTCGCACCTCGGG
GACCCGTTCTCCATCAACCCGCTGCACCAGCCGCCGCCGCCGCCCCCCAGCCAGCAGCAGAGCGCTTGGCCCAACCGCC
AGAGCCAGGAGCCCGCCGGCCTCCCCCCGCACGGCCGCCCCGGCCTCGTCCCGCACCTCTCGGCGCTGGAGAGCGGCTC
GGCCGGCGGCCGTCGGGAAACGTTCCGGCGCTCCGACCTCTTGTTGCCCCACGGGCACGGCCTGGATGCCTCGGCGCTG
GCCGACAACCTGGGGCTCCACGACATGGCCCATCAGATAGAGGACGTACAGAACGTGGAAGACCAACACTTACTAATGC
ACGACCAGACGGTCATTAGAAAAGGTCCCATTTCCTTAACGAAGAACAGCGCTCTGAGCCTCCCCTGCCAGAAGGACGG
ACTGATCGGAGTGGTCATAAACCCCAACGAAGTGTTCTGCTCCGTGCCGGGGCGGCTGTCCCTCCTCAGCTCCACATCG
AAGTACAAAGTGACCGTGGCGGAGGTGCAGAGGCGGCTCTCTCCCCCGGAGTGTCTCAATGCCTCTCTGCTGGGAGGTG
TGCTCCGAAGAGCCAAATCTAAAAATGGTGGCAGATCATTAAGGGAAAAACTGGATAAAATTGGCTTGAACCTTCCAGC
TGGTAGAAGGAAAGCTGCAAATGTGACACTATTGACATCTTTGGTGGAAGGTGAAGCTGTGCACCTCGCTCGTGACTTC
GGATACGTGTGTGAGACTGAGTTCCCCTCCAAGGCTGTGGCTGAGTACCTGACCCGGCCGCACATGGGCCGCAACGAGA
TGGCCAACAGGAAGAACATGCTGCTGGCTGCCAAGCAGATCTGTAAGGAATTCACAGACCTCCTCACTCAGGACAGAAC
TCCGCTGGGAAACACGAGACCCAGTCCCATCCTGGACCCTGGCATCCAGGGCTGTTTGACTCATTTTAGCCTGATCACA
CATGGCTTTGGGAGCGCCGCCATCTGTGCTGCCATGACATCCGTCCAGAACTACCTAAATGAAGCATTAAAAATAGCAG
ACAAAACATACATGAACACAGGCGACCAGAGCCCTGCAGAAACCAACAAAACCATCGATAAAATGGACAAGCACAGGAA
GTAAAGGGGAACAAACAGACTCGAGACTCTTCCTCCTTAACGCAGACTGGGATCTTCTTGCCGGGGGGAACGTAGCAAT
TTGGGTACTTTTTTTTTTTTCTTCTTTATTAAGAAAGGAGGGAAAAGGAAACGAGAACAAAACCATTTGGGATCTTCAC
TCCTCCTGGATCCAGGAGACAAGTCTTTCCAAAAGCTGCCGCATCCCTTCTCTGTGGAAGCAGTGACCTGAAGATAAGT
ACTTGGTACCCGTGTGTTGCCATCCTTTGCTGTAAAAGTGGTGCTATAGGGGTTTCTCATGGAAGTGTACGAAGAGATG
AAATACGTAGATTGCTTTCCCACATCTCCGTACCTGGTGGCGACCAGCACCGTGTGTAGTTCTTAAGAGACAGATTTGA
CATGGGAGGTTATTTGTGATCAGATAAATTTTCAGGGTTTTATTCTCTCTTAATACAACAGCAACAGTAAAGCAGTATT
AAACAACGCTATATAGATTTATGTACATTAAAATTTTTTTATAAACACCCGAAATAGTAAGATTACTCTTTTTCCTTTT
TGTTCTTTTTCCCTTTATTTTCAGATTACCGTAAGAGAGTGCTAAAATCCTGGTGGATAAT
CitationLi X, Glubrecht DD, Mita R, Godbout R. Expression of AP-2delta in the developing chick retina. Dev Dyn. 2008 Nov;237(11):3210-21.
CopyrightCopyright © 2008 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # XM_417497.3)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 27
Retina
 
31-41
stage 31
stage 37
stage 41
Retina
 

Entry 2

GEISHA IdAP2Y.Qiao.2012Data SourcePublication
Complete cDNA Template Probeshow
ATGTTGTGGAAACTGGCAGATAACGTCAAGTACGAGGAGGACTGCGAGGACCGCCACGATGGGAGCAGCAACGGGAACC
CGCGGCTCCCGCACCTCTCGGCGGTCAGCCAGCACCTGTACAGCCCGGCCCCGCCGCTCTCCCACTCCGGAGCCTCCGA
CTTCCAGCCTCCTTACTTCCCCCCCCCTTACCAGCCGCTGCCTTACTCCCAATCCAGCGACCCCTACTCGCACCTCGGG
GACCCGTTCTCCATCAACCCGCTGCACCAGCCGCCGCCGCCGCCCCCCAGCCAGCAGCAGAGCGCTTGGCCCAACCGCC
AGAGCCAGGAGCCCGCCGGCCTCCCCCCGCACGGCCGCCCCGGCCTCGTCCCGCACCTCTCGGCGCTGGAGAGCGGCTC
GGCCGGCGGCCGTCGGGAAACGTTCCGGCGCTCCGACCTCTTGTTGCCCCACGGGCACGGCCTGGATGCCTCGGCGCTG
GCCGACAACCTGGGGCTCCACGACATGGCCCATCAGATAGAGGACGTACAGAACGTGGAAGACCAACACTTACTAATGC
ACGACCAGACGGTCATTAGAAAAGGTCCCATTTCCTTAACGAAGAACAGCGCTCTGAGCCTCCCCTGCCAGAAGGACGG
ACTGATCGGAGTGGTCATAAACCCCAACGAAGTGTTCTGCTCCGTGCCGGGGCGGCTGTCCCTCCTCAGCTCCACATCG
AAGTACAAAGTGACCGTGGCGGAGGTGCAGAGGCGGCTCTCTCCCCCGGAGTGTCTCAATGCCTCTCTGCTGGGAGGTG
TGCTCCGAAGAGCCAAATCTAAAAATGGTGGCAGATCATTAAGGGAAAAACTGGATAAAATTGGCTTGAACCTTCCAGC
TGGTAGAAGGAAAGCTGCAAATGTGACACTATTGACATCTTTGGTGGAAGGTGAAGCTGTGCACCTCGCTCGTGACTTC
GGATACGTGTGTGAGACTGAGTTCCCCTCCAAGGCTGTGGCTGAGTACCTGACCCGGCCGCACATGGGCCGCAACGAGA
TGGCCAACAGGAAGAACATGCTGCTGGCTGCCAAGCAGATCTGTAAGGAATTCACAGACCTCCTCACTCAGGACAGAAC
TCCGCTGGGAAACACGAGACCCAGTCCCATCCTGGACCCTGGCATCCAGGGCTGTTTGACTCATTTTAGCCTGATCACA
CATGGCTTTGGGAGCGCCGCCATCTGTGCTGCCATGACATCCGTCCAGAACTACCTAAATGAAGCATTAAAAATAGCAG
ACAAAACATACATGAACACAGGCGACCAGAGCCCTGCAGAAACCAACAAAACCATCGATAAAATGGACAAGCACAGGAA
GTAAAGGGGAACAAACAGACTCGAGACTCTTCCTCCTTAACGCAGACTGGGATCTTCTTGCCGGGGGGAACGTAGCAAT
TTGGGTACTTTTTTTTTTTTCTTCTTTATTAAGAAAGGAGGGAAAAGGAAACGAGAACAAAACCATTTGGGATCTTCAC
TCCTCCTGGATCCAGGAGACAAGTCTTTCCAAAAGCTGCCGCATCCCTTCTCTGTGGAAGCAGTGACCTGAAGATAAGT
ACTTGGTACCCGTGTGTTGCCATCCTTTGCTGTAAAAGTGGTGCTATAGGGGTTTCTCATGGAAGTGTACGAAGAGATG
AAATACGTAGATTGCTTTCCCACATCTCCGTACCTGGTGGCGACCAGCACCGTGTGTAGTTCTTAAGAGACAGATTTGA
CATGGGAGGTTATTTGTGATCAGATAAATTTTCAGGGTTTTATTCTCTCTTAATACAACAGCAACAGTAAAGCAGTATT
AAACAACGCTATATAGATTTATGTACATTAAAATTTTTTTATAAACACCCGAAATAGTAAGATTACTCTTTTTCCTTTT
TGTTCTTTTTCCCTTTATTTTCAGATTACCGTAAGAGAGTGCTAAAATCCTGGTGGATAAT
CitationQiao Y, Zhu Y, Sheng N, Chen J, Tao R, Zhu Q, Zhang T, Qian C, Jing N. AP2γ regulates neural and epidermal development downstream of the BMP pathway at early stages of ectodermal patterning. Cell Res. 2012 Nov;22(11):1546-61.
Copyright© 2012 Shanghai Institutes for Biological Sciences
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # XM_417497.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 4
stage 5
stage 6
Ectoderm
Epiblast
Headfold
Lateral Plate Mesoderm
Stage HH4
Stage HH4+
Stage HH4-

Mouse

EmageMGI:106032
EurexpressMGI:106032
MGI GXDMGI:106032

Frog

Xenbase488670

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-041212-61
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona