GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ATF3
activating transcription factor 3

Gene
Official SymbolATF3
Official Full Nameactivating transcription factor 3
CGNC ID7459
also known ascyclic AMP-dependent transcription factor ATF-3
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_419429
PolypeptideXP_419429
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human467ENSG00000162772MIM:603148
Mouse11910ENSMUSG00000026628All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:109384
Xenopus100494437, 4473116085250
Zebrafish393939ENSDARG00000007823ZDB-GENE-040426-728ZFIN:ZDB-GENE-040426-728
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene421369
Ensembl Gene
KEGGgga:421369
GEISHA IdATF3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATTCAGCGCCTCCGCAATTGTCC
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGGCTTTCCCTGACAGCCACAAGGAcDNA Template Length911
Forward cDNA Template Probeshow
CCCCCGGGCCCTCACAGGNAAAGTNTGTCCATCCAGCACAGCGGGTATGTACCATGTGCATCATCGAAGTCATAGTGTT
CTAGCACAAACGTCGTGAGTGCAGATACTGTATACTAGCAGAGAGCTAAATCTTCTGAAGCTGTTGTCTGTAGCTCCTA
GGAACAGCATGTATGACAGGTGCAAAACCTATTATGAGGCAGAAGGCTCTTCAGTTGGACCGAGACCAGATCTTCCGAG
GGGAAGAATCTCTGACAAGCCAAAAATGATTTGTTCTGCTTAAGAAAGCGATCTGCCCTTCCTAAACGCTCTTTACTAT
TAGAATCCTACACATAAGTCAGATCCTCTGTGGATTCTGTTGCTGTTAAAACATACTAGAAATATTTCCACATTTTCCG
TATCACTTAACCTTGTAATGTTCCTTCTTTGATCTGTTGAATAAAAAGATTCCTTTCATCTTCAGGTGTCCTTCCATTT
TGTGCCCGGACTATACAGGTGGGCCTGTGAAGATTTAGCATGTATATCAAATGCTGCTTCTCATTCTTTAGCTCTTCAA
TCTGGGCTTTTAATTCCGCATTGATAGTCTCCAGCTTTTCTGATTCTTTCTGCAAACATTCTGTTTTTTCCTTCTTTTT
GTTTCGGCACTTTGCAGCAGCAATTTTGTTCCTTTCCCTTCTTCGCTTTTTTCTTTCATCCTCTTCAGGAGAAAACTCC
GTTTTCATGATCGATGTTTCCATCGGCCTTTCGGACACTGTCACCGTATCCAAAGTAGAAGACATCCTGTGGGACTGAC
GTTTGTTTTGGATGGCGAATCTAAGTTCCTCTTTCACCAGTGGGGTTAGATTTGTGAAATCATCAAACCCCAGTGACCC
TGCAGGGGACAAAGTGGGGACAATTGCGGAGGCGCTGAATATTCTGCGGCCGCAGCCTTTTAAAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
stage 6
Early Mesoderm
Germinal Crescent
Headfold
Lateral Plate Mesoderm
 
7-12
stage 8
stage 8
stage 9
stage 10
stage 11
Anterior Intestinal Portal
Anterior/Second Heart Field
Intermediate Mesoderm
Lateral Plate Mesoderm
 
13-18
stage 13
stage 16
stage 17
Anterior Intestinal Portal
Blood Vessels
Gut
Intermediate Mesoderm
Lateral Plate Mesoderm
Nephric Ducts
Pharyngeal Arches and Clefts
 
19-24
stage 21
stage 23
Gut
Nephric Ducts
Nephric Tubules
Outflow Tract
Pharyngeal Arches and Clefts
Tail
 
25
stage 25
Gut
Liver
Nephric Ducts
 

Mouse

EmageMGI:109384
EurexpressMGI:109384
MGI GXDMGI:109384

Frog

Xenbase6085250

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-728
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona