Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
ATP6V0E2 Gene Summary Expression Other Species Expression JBrowse Gene Official Symbol ATP6V0E2 Official Full Name ATPase H+ transporting V0 subunit e2 CGNC ID 14310 also known as V-type proton ATPase subunit e 2 gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function Biological Process Cellular Component
Links to other databases
GEISHA Id ATP6V0E2.Roy.2013 Data Source Publication Complete cDNA Template Probe show GGCAGGGCGGTCAGCGCGCGGCGCTCTCTACGCCGATTGGCCGCCCCCCGCGGCAGTGGGCGGGACGTTAGCCTGAGCG
Citation Roy P, Kumar B, Shende A, Singh A, Meena A, Ghosal R, Ranganathan M, Bandyopadhyay A. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes. PLoS One. 2013 May 22;8(5):e63670 Copyright This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_001277387
Stage Image (click image to view full size) Location (click to highlight) Comments (click to highlight) 13-18
stage 18
stage 18
Cranial Ganglia
Mouse Frog Fruit Fly Zebra Finch Zebrafish
