GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

TFAP2A
transcription factor AP-2 alpha

The human orthologue of this gene is associated
with the following human disease:
Gene
Official SymbolTFAP2A
Official Full Nametranscription factor AP-2 alpha
CGNC ID9685
also known asTFAP2, transcription factor AP-2-alpha|AP-2 transcription factor|transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)|transcription factor AP2, AP-2 transcription factor, TFAP2a, transcription factor AP-2 alpha
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205094
PolypeptideNP_990425
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.2351
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly40398FBgn0261953
Human7020ENSG00000137203MIM:113620MIM:107580
Mouse21418ENSMUSG00000021359All phenotypic alleles (7):Chemically induced(1) Targeted, knock-out(2) Targeted, other(4) MGI:104671
Xenopus395064, 503683, 394344481200
Zebrafish140618ENSDARG00000059279ZDB-GENE-011212-6ZFIN:ZDB-GENE-011212-6
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395982
Ensembl Gene
KEGGgga:395982

Entry 1

GEISHA IdAp2.Chapman.2008Data SourceDirect Submission
Complete cDNA Template Probeshow
CGAGGCTCAGCGCACAGCGGCTCTGCACAGTCCGCCGCGCTCCGCAGCACCGCGCCGGGGGGATCGGACCCTCTCCCGC
CGACCCATGAAAATGCTCTGGAAGCTGACGGATAACATCAAGTACGAGGAGTGCGAGGAGCGCCACGACAGTGCCAGCA
ACGGGACGGCGCGGCTGCCCCAGCTGGGGGCCGTGGGGCAGTCCCCGTATAGCAGCGCCCCGCCGCTCTCGCACACCCC
CAACGCCGACTTCCAGCCGCCCTACTTCCCCCCCCCGTACCAGCCCATCTACCCCCAGTCTCAGGACCCCTACTCCCAC
GTCAACGACCCCTACAGCCTCAACTCCCTGCACACCCAGCCGCAGCCCCAGCACCCGGCGTGGCCGGGCCAGAGGCAGA
GCCAGGAGCCGAGCTTGCTGCACGCGCACCGGGGGCTGCCCCACCAGCTGGGGGGGTTGGACCCCCGCCGCGACTACCG
GCGGCACGACGACCTGCTGCACGGCCCGCACGGGCTGGGAGCGGGGCTGGCCGACCTGCCGCTGCACTCCATCCCTCAC
GCCATCGAGGACGTGCCGCACGTAGACGACCCCGGCATCAACATCCCGGACCAGACCGTCATTAAGAAAGGCCCCGTGT
CCCTCTCCAAGTCTAACAACAACGCCGTCTCCTCCATCCCCATCAACAAGGACGCGCTCTTCGGCGGGGTGGTGAACCC
CAACGAGGTCTTCTGCTCGGTGCCGGGCCGCCTCTCGCTGCTCAGCTCCACCTCCAAGTACAAGGTCACGGTGGCGGAA
GTGCAGCGACGCCTCTCGCCGCCCGAGTGCCTCAACGCCTCCCTGCTGGGCGGAGTGCTGAGGAGGGCAAAGTCCAAAA
ATGGCGGGAGGTCCCTCCGAGAGAAGCTGGACAAGATAGGGTTGAACCTGCCGGCCGGGAGGCGCAAAGCTGCTAATGT
CACCTTGCTCACCTCGCTGGTGGAGGGGGAAGCAGTGCATCTAGCTAGAGATTTTGGGTACGTTTGTGAGACAGAATTT
CCTGCCAAAGCAGTAGCTGAATTTCTCAACCGACAACATTCCGATCCAAACGAGCAAGTCACAAGAAAAAACATGCTTC
TAGCTACAAAACAGATCTGTAAAGAGTTCACCGACCTGCTGGCTCAGGACCGATCTCCCCTGGGGAACTCGCGGCCCAA
CCCCATTTTGGAGCCGGGCATCCAGAGCTGCCTGACCCACTTCAACCTCATCTCGCACGGCTTCGGGAGCCCGGCGGTA
TGCGCTGCCGTCACCGCCCTGCAGAACTATCTCACCGAGGCGCTCAAGGCCATGGACAAAATGTACCTCAGCAACAACC
CCAACAGCCACACAGACAACAGCACCAAAAGCAGCGACAAAGAGGAGAAGCACCGAAAGTGAGGATTCCCCCCCACTCC
TCTCCCTTCCCCCCCTCGCAGCCCATCAGTCCATTCACTCTCCCTCCTCCCTCTGCCCTGCACCCAGCACCCCAGGCTA
CGGCAACAGAATGAGCATCCTTCTGCCAATCCTGTTCTCTGACTCTGCGAGACCGCTCTGCCCTCATCCCCGCGACCCC
CTTCCCTGGCATCCACATCTTCATTTGCTCCCACTTTTAACTCGTTCCCCCTCTCCCGCTGCACCATCGTTTTGCTACC
CCAGTTTGGAGCCTAAGAGAACAGAAAACAGGGGGACGGAGCCAGCAAAAAGTAAAAGTTCTGTCTTGAGTTTGTGAAC
TTTTTTTTTTAAATAAAACAAAAGGAGGAAAAAAAAAAACAAAACAAAACGAAAAAAAAAAACAAAAGGACTTTTTTTT
TCTAAAAATATATTAAAAAACCTAAAAAAAAAAAAAAAAAA
CommentsImages Provided by Susan Chapman
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
Area Opaca
Area Pellucida
Extraembryonic
 

Entry 2

GEISHA IdAP-2α.Khudyakov.2009Data SourcePublication
Complete cDNA Template Probeshow
ACCAGACCGTCATTAAGAAAGGCCCCGTGTCCCTCTCCAAGTCTAACAACAACGCCGTCTCCTCCATCCCCATCAACAA
GGACGCGCTCTTCGGCGGGGTGGTGAACCCCAACGAGGTCTTCTGCTCGGTGCCGGGCCGCCTCTCGCTGCTCAGCTCC
ACCTCCAAGTACAAGGTCACGGTGGCGGAAGTGCAGCGACGCCTCTCGCCGCCCGAGTGCCTCAACGCCTCCCTGCTGG
GCGGAGTGCTGAGGAGGGCAAAGTCCAAAAATGGCGGGAGGTCCCTCCGAGAGAAGCTGGACAAGATAGGGTTGAACCT
GCCGGCCGGGAGGCGCAAAGCTGCTAATGTCACCTTGCTCACCTCGCTGGTGGAGGGGGAAGCAGTGCATCTAGCTAGA
GATTTTGGGTACGTTTGTGAGACAGAATTTCCTGCCAAAGCAGTAGCTGAATTTCTCAACCGACAACATTCCGATCCAA
ACGAGCAAGTCACAAGAAAAAACATGCTTCTAGCTACAAAACAGATCTGTAAAGAGTTCACCGACCTGCTGGCTCAGGA
CCGATCTCCCCTGGGGAACTCGCGGCCCAACCCCATTTTGGAGCCGGGCATCCAGAGCTGCCTGACCCACTTCAACCTC
ATCTCGCACGGCTTCGGGAGCCCGGCGGTATGCGCTGCCGTCACCGCCCTGCAGAACTATCTCACCGAGGCGCTCAAGG
CCATGGACAAAATGTACCTCAGCAACAACCCCAAACAGCCACACAGACAACAGCACCAAAAGCAGCGACAAAGAGGAAA
AGCACCGAAG
CitationKhudyakov J, Bronner-Fraser M. Comprehensive spatiotemporal analysis of early chick neural crest network genes. Dev Dyn. 2009 Mar;238(3):716-23.
CopyrightPublished Online: 22 Feb 2009 Copyright © 2009 Wiley-Liss, Inc.
CommentsThe sequence below was obtained from NCBI (BU230321) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 4
stage 4
stage 5
stage 6
Ectoderm
Non-neural Ectoderm
Preplacodal Region
7-10
stage 7
stage 7
stage 8
stage 9
stage 10
stage 10
Ectoderm
Neural Crest
Neural Plate/Tube
Non-neural Ectoderm
Non-neural Ectoderm

Entry 3

GEISHA IdAP2alpha.Blentic.2008Data SourcePublication
Complete cDNA Template Probeshow
CGAGGCTCAGCGCACAGCGGCTCTGCACAGTCCGCCGCGCTCCGCAGCACCGCGCCGGGGGGATCGGACCCTCTCCCGC
CGACCCATGAAAATGCTCTGGAAGCTGACGGATAACATCAAGTACGAGGAGTGCGAGGAGCGCCACGACAGTGCCAGCA
ACGGGACGGCGCGGCTGCCCCAGCTGGGGGCCGTGGGGCAGTCCCCGTATAGCAGCGCCCCGCCGCTCTCGCACACCCC
CAACGCCGACTTCCAGCCGCCCTACTTCCCCCCCCCGTACCAGCCCATCTACCCCCAGTCTCAGGACCCCTACTCCCAC
GTCAACGACCCCTACAGCCTCAACTCCCTGCACACCCAGCCGCAGCCCCAGCACCCGGCGTGGCCGGGCCAGAGGCAGA
GCCAGGAGCCGAGCTTGCTGCACGCGCACCGGGGGCTGCCCCACCAGCTGGGGGGGTTGGACCCCCGCCGCGACTACCG
GCGGCACGACGACCTGCTGCACGGCCCGCACGGGCTGGGAGCGGGGCTGGCCGACCTGCCGCTGCACTCCATCCCTCAC
GCCATCGAGGACGTGCCGCACGTAGACGACCCCGGCATCAACATCCCGGACCAGACCGTCATTAAGAAAGGCCCCGTGT
CCCTCTCCAAGTCTAACAACAACGCCGTCTCCTCCATCCCCATCAACAAGGACGCGCTCTTCGGCGGGGTGGTGAACCC
CAACGAGGTCTTCTGCTCGGTGCCGGGCCGCCTCTCGCTGCTCAGCTCCACCTCCAAGTACAAGGTCACGGTGGCGGAA
GTGCAGCGACGCCTCTCGCCGCCCGAGTGCCTCAACGCCTCCCTGCTGGGCGGAGTGCTGAGGAGGGCAAAGTCCAAAA
ATGGCGGGAGGTCCCTCCGAGAGAAGCTGGACAAGATAGGGTTGAACCTGCCGGCCGGGAGGCGCAAAGCTGCTAATGT
CACCTTGCTCACCTCGCTGGTGGAGGGGGAAGCAGTGCATCTAGCTAGAGATTTTGGGTACGTTTGTGAGACAGAATTT
CCTGCCAAAGCAGTAGCTGAATTTCTCAACCGACAACATTCCGATCCAAACGAGCAAGTCACAAGAAAAAACATGCTTC
TAGCTACAAAACAGATCTGTAAAGAGTTCACCGACCTGCTGGCTCAGGACCGATCTCCCCTGGGGAACTCGCGGCCCAA
CCCCATTTTGGAGCCGGGCATCCAGAGCTGCCTGACCCACTTCAACCTCATCTCGCACGGCTTCGGGAGCCCGGCGGTA
TGCGCTGCCGTCACCGCCCTGCAGAACTATCTCACCGAGGCGCTCAAGGCCATGGACAAAATGTACCTCAGCAACAACC
CCAACAGCCACACAGACAACAGCACCAAAAGCAGCGACAAAGAGGAGAAGCACCGAAAGTGAGGATTCCCCCCCACTCC
TCTCCCTTCCCCCCCTCGCAGCCCATCAGTCCATTCACTCTCCCTCCTCCCTCTGCCCTGCACCCAGCACCCCAGGCTA
CGGCAACAGAATGAGCATCCTTCTGCCAATCCTGTTCTCTGACTCTGCGAGACCGCTCTGCCCTCATCCCCGCGACCCC
CTTCCCTGGCATCCACATCTTCATTTGCTCCCACTTTTAACTCGTTCCCCCTCTCCCGCTGCACCATCGTTTTGCTACC
CCAGTTTGGAGCCTAAGAGAACAGAAAACAGGGGGACGGAGCCAGCAAAAAGTAAAAGTTCTGTCTTGAGTTTGTGAAC
TTTTTTTTTTAAATAAAACAAAAGGAGGAAAAAAAAAAACAAAACAAAACGAAAAAAAAAAACAAAAGGACTTTTTTTT
TCTAAAAATATATTAAAAAACCTAAAAAAAAAAAAAAAAAA
CitationBlentic A, Tandon P, Payton S, Walshe J, Carney T, Kelsh RN, Mason I, Graham A. The emergence of ectomesenchyme. Dev Dyn. 2008 Mar;237(3):592-601.
CopyrightCopyright © 2008 John Wiley & Sons, Inc. All Rights Reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # NM_205094)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 15
Neural Crest
Pharyngeal Arches and Clefts
 
19
stage 19
Neural Crest
Pharyngeal Arches and Clefts
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.2351

Mouse

EmageMGI:104671
EurexpressMGI:104671
MGI GXDMGI:104671

Frog

Xenbase481200

Fruit Fly

BDGPFBgn0261953

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-011212-6
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona