GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

BACH2
BTB domain and CNC homolog 2

Gene
Official SymbolBACH2
Official Full NameBTB domain and CNC homolog 2
CGNC ID11632
also known astranscription regulator protein BACH2|BTB and CNC homology 1, basic leucine zipper transcription factor 2|BTB and CNC homology 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_419833
PolypeptideXP_419833
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.11181
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human60468ENSG00000112182MIM:605394
Mouse
Xenopus100485849994312
Zebrafish555350ENSDARG00000004074ZDB-GENE-041001-139, ZDB-GENE-120525-2ZFIN:ZDB-GENE-041001-139, ZFIN:ZDB-GENE-120525-2
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene421809
Ensembl Gene
KEGGgga:421809

Entry 1

GEISHA IdChEST1024h14Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCGGCTCGAGCGCGGAGGCGCGGCGAGAGCGATGAGGCAAGAGAGAAGTTTTTAAAAACAGAAAAATGTGATTGCAGAA
ACATCATTGTTGGCAGGAGGACTCGGTGGATTCAGATATAACTGTAGGTGCTTCTTGTATGAAAGAGCTGAGCCACACC
ATCCAGTAAACTGTCTAAAGCAGCTGTTGGCTTGCTTGGAAATCACTTCCAGAACTGTTGTAAGTTGATATTGACTGAG
TTGCCAGCACATTGCCCTGCAAAGCTTTGGAGGGCCACTTCTTAATGGATTGCTGTAGCCTCTTAATTTCTCCACTGAT
CCTGTTCCCTGCATCGTGAGAACAATTTAGCCAGCACAGAACCTAGAAAAGTTACATGGTGTGAACGGCATGTCTGTGG
ATGAGAAGACTGACTCCCCCATGTATGTGTATGAGTCAACAGTGCACTGTACCAATATTCTCCTCTGCTTAAATGACCA
GCGCAAGCAGGATATTCTCTGCGACGTGACACTCATCGTGGAGGGGAAGGAGTTCCGCGCCCACCGGGCTGTGCTGGCC
GCCTGCAGCGAGTACTTCTTGCAGGCCTTGGTGGGGCAGACGGAAAATGACCTGGTTGTCAGCCTGCCAGAAGAGGTCA
CTGTCAGAGGATTTGGTCCATTGCTACAGTTTGCCTACACTGCTAAGCTGTTACTCAGCAGAGAAAACATCCAGGAGGT
CATCCACTGTGCTGAGTTCCTGCGCATGCACAACCTGGAGGACTCCTGCTTCAGCTTCCTTCAGACGCAGCTGCTGAAC
AACGAAGATGGCCTGTTCCTGTGCAAAAGGATACCACTTGTCAGCGCATGCATGATG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
Area Pellucida
Ubiquitous
 
7-12
stage 9
stage 10
Extraembryonic
Lateral Plate Mesoderm
 
13-18
stage 17
Heart Tube
Limb Buds
Paraxial Mesoderm
 
19-21
stage 21
stage 21
Cranial Ganglia
Face Mesenchyme
Limb Buds
Nasal Placcode/Nerve
Paraxial Mesoderm
Pharyngeal Arches and Clefts
 

Entry 2

GEISHA IdBACH2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATTCAGGGGGCCCGGCTTTGAA
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGTGGCTACTCTGCTCTCGCGGAcDNA Template Length1213
Forward cDNA Template Probeshow
GGGGGCCCGGCTTTGAAACTCTCTGTAAGCAAGAGGGGGAACTGGACAGGAGGAGTGTTATATTCTCTTCAAACGCTTG
TGACCAAGTAAACACTTCGGTGCATTCATATTCTGGTGTGAGCAGCTTGGACAAAGACCTCACTGAGACTGTGCCAAAG
GGTCTGTGGGCTGGCGGTAGCCAGTCTCTCCCCAGCTCTCAGACCTATTCCCACAGCGGACTGACAGCTGATCACTTGT
CAGGAAGGATGCGGCCGAACACCAGCTGTCCAGTGCCAATTAAAGTTTGCCCTCGCTCACCTCCTTTAGAGACCAGAAC
GAGGACCTCCAGCTCGTGTTCTTCCTACTCATATGCAGAGGACGGCAGCGGCGGCTCTCCCTGCAGCCTACGTCTGTGT
GAGCTCTCCTCTTCCCCTTGCTCCCAAGGCCCCCGATTCCTGGCGCCCGAGCACCAGGAGCCCGGTGTGGTGGGAGATG
GATTGTACAACCCAGTTCGAGCCCAGATTAAATGTGAGCCATCCTATGGAACAAACTCCAGCGATGAGTCTGGGTCATT
CTCAGAAGCAGACAGTGAATCATGTCCTGTGCAAGACAGAGGGCATGAGGTGAAACTTCCTTTTCCTGTTGATCAAATC
ACAGATCTTCCAAGGAATGATTTCCAGATGATGATAAAGATGCACAAACTAACCTCAGAACAGCTCGAGTTCATCCATG
ATGTTCGCCGGCGCAGCAAGAACCGAATTGCAGCTCAGCGCTGCCGCAAGAGAAAACTGGACTGTATTCAGAACCTCGA
ATGTGAAATCCGCAAGTTGGTGTGTGAGAAAGAGAAGTTGCTCTCAGAAAGGAACCAGCTGAAAGCAAGCATGGGCGAA
CTGCTAGATAACTTCTCGTGTCTTTCCCAAGAAGTGTGCAGAGACATGCAGAGCCCGGAACAGATCCAAGCCCTTCACC
GCTACTGCCCTGTTCTCAGACCCATGGATCTGCAGACGGCCACCAACATCAGCCCCCCAACGGGCGTGGAGCAGGGCCT
GGCGACGTCGCAGTGTGTTGGGGAAGGCATGCAGTGCTGCTCAGAGCAGGGCCCCGTGCAGCTGGGAGCATCCTGGCTG
CCCAACAATGTCTCAGAGAATTGCTCGGCCAGCGGCGGGGGGTTGGATGGAGCTGAGCCAGGTACTTACCCTGAGAGAG
AGCTTCCGCGAGAGCAGAGTAGCCAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Epiblast
Hensen's Node
Primitive Streak
 
4-6
stage 4
stage 6
Epiblast
Headfold
Hensen's Node
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
 
7-12
stage 8
stage 9
stage 11
Anterior Intestinal Portal
Extraembryonic Mesoderm
Heart
Heart Tube
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somites
 
13-18
stage 15
stage 17
Anterior/Second Heart Field
Heart Tube
Limb Buds
Somatic Mesoderm
Somites
 
19-24
stage 23
Eye
Heart
Leg Mesenchyme
Neural Plate/Tube
Pharyngeal Arches and Clefts
Somites
Spinal Cord
Widespread Expression
Wing Mesenchyme
 
25
stage 25
stage 25
Eye
Heart
Leg Mesenchyme
Neural Plate/Tube
Pharyngeal Arches and Clefts
Somites
Spinal Cord
Widespread Expression
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.11181

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase994312

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-041001-139, ZDB-GENE-120525-2
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona