GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

BMI1
BMI1 proto-oncogene, polycomb ring finger

Gene
Official SymbolBMI1
Official Full NameBMI1 proto-oncogene, polycomb ring finger
CGNC ID54322
also known aspolycomb complex protein BMI-1|B lymphoma Mo-MLV insertion region|BMI1 polycomb ring finger oncogene|polycomb group RING finger protein 4
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001007988
PolypeptideNP_001007989
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.22845
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Functionzinc ion binding
Biological Processchromatin modification, negative regulation of apoptotic signaling pathway, more...positive regulation of B cell proliferation, positive regulation of immature T cell proliferation in thymus, positive regulation of ubiquitin-protein ligase activity, regulation of transcription, DNA-templated, transcription, DNA-templated
Cellular ComponentPcG protein complex, ubiquitin ligase complex
Links to other databases
Entrez Gene493647
Ensembl Gene
KEGGgga:493647

Entry 1

GEISHA IdBMI1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTGGCTCTAATGAAGACAGGGGAG
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGTGCTGGAGATGTGTGGGAACTGcDNA Template Length551
Forward cDNA Template Probeshow
CAGNGGGGGGGATGGNACGGCGTGCTGGGGCTGGGCAGGCAGGAGGAGGTGGAGGGCAGCCCCCCGGCCGGGCTGCTGG
CCTTGTCGCTGCCGGAGTCGCTCTCCAGCTCGCCGCTGTTGCTGAGGCCTTCCCGCTGGTGGCCGATCTTCATCCTCTT
GCAGGTGGGCCGCACGCGGTACTTGAGGGGCAGCGGGCCGTTCCGTCTCCAGGTGTAGATGTAGGCAATGTCCATCAGC
GTGTAGTAGTCCTTCAGGGGCTCCTCCTCGTACATCACGTCGATCTGGAAAGTGTTGGGGATATCCATCTTACTCCGCA
GGAACTTTCGTAGATGCATCACTGTCATCGCTGCCGGGCAGCGCAAATATCTTTTGTCGTTCACCTCCTCCTTCGACTT
TTCTTTCTCTTTATTTCCTTTTCGTTCCAGTCTGTTCTGGTCAAAGAACTCAATGGATAAGCTTATTATCTCGTCGTCT
GTTATAATTCTTTTGTCTTCGTCAGCCACTTCTCCCCTGTCTTCATTTAGAGCCAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
Unlabeled
 
7-12
stage 8
stage 10
stage 10
stage 11
Amnion
Anterior Intestinal Portal
Area Opaca
Blood Islands
Eye
Forebrain
Head Mesenchyme
Heart
Heart Tube
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Primitive Streak
Sinus Venosus
Somites
 
13-18
stage 18
stage 18
stage 18
Dermatome
Eye
Neural Plate/Tube
Notochord
Pharyngeal Arches and Clefts
Sclerotome
 
19-24
stage 19
stage 22
stage 22
stage 22
Dermatome
Eye
Foregut
Head Mesenchyme
Lung
Mesonephros
Myotome
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
 
25-26
stage 26
Foregut
Head Mesenchyme
Sclerotome
 

Entry 2

GEISHA IdBMI1.Fraser.2004Data SourcePublication
Complete cDNA Template Probeshow
ATGCACCGGACGACCAGGATCAAAATCACCGAGCTGAACCCGCACCTCATGTGCGTGCTGTGCGGCGGGTACTTCATCG
ACGCGACGACCATCATCGAGTGCCTGCACTCCTTCTGCAAGACGTGCATCGTGCGGTACTTGGAGACGAGCAAGTACTG
CCCGATCTGCGACGTCCAAGTGCACAAAACCCGGCCGCTGCTCAACATCAGGTCAGATAAAACTCTCCAGGATATCGTG
TACAAGCTCGTACCGGGCCTTTTCAAAAATGAAATGAAAAGAAGAAGGGATTTCTATGCTGCTCATCCGTCGGCTGATG
CTGCCAATGGCTCTAATGAAGACAGGGGAGAAGTGGCTGACGAAGACAAAAGAATTATAACAGACGACGAGATAATAAG
CTTATCCATTGAGTTCTTTGACCAGAACAGACTGGAACGAAAAGGAAATAAAGAGAAAGAAAAGTCGAAGGAGGAGGTG
AACGACAAAAGATATTTGCGCTGCCCGGCAGCGATGACAGTGATGCATCTACGAAAGTTCCTGCGGAGTAAGATGGATA
TCCCCAACACTTTCCAGATCGACGTGATGTACGAGGAGGAGCCCCTGAAGGACTACTACACGCTGATGGACATTGCCTA
CATCTACACCTGGAGACGGAACGGCCCGCTGCCCCTCAAGTACCGCGTGCGGCCCACCTGCAAGAGGATGAAGATCGGC
CACCAGCGGGAAGGCCTCAGCAACAGCGGCGAGCTGGAGAGCGACTCCGGCAGCGACAAGGCCAGCAGCCCGGCCGGGG
GGCTGCCCTCCACCTCCTCCTGCCTGCCCAGCCCCAGCACGCCGGTCCAGTCCCCCCACCCGCAGTTCCCACACATCTC
CAGCACCATGAACGGCACCAGCAGCAGCCCCGGCAGCAACCACCAGTCCTCCTTCACCAACAGAGCACGGAAATCCTCC
ATAAACGGCTCCTCAGCCACTTCGTCCGGCTGA
CitationFraser PE, Sauka-Spengler T. GExpression of the polycomb group gene bmi-1 in the early chick embryo. Gene Expr Patterns. 2004 Nov;5(1):23-7.
CopyrightReprinted from Gene Expr Patterns, Volume 5(1), Fraser PE, Sauka-Spengler T, Expression of the polycomb group gene bmi-1 in the early chick embryo, Pages 23-7, Copyright (2004), with permission from Elsevier". Copyright © 2004 Published by Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (AY616032)."
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
Area Pellucida
Epiblast
Neural Plate/Tube
 
7-12
stage 7
stage 8
stage 9
stage 10
stage 12
Ear/Otic Placcode
Epiblast
Nasal Placcode/Nerve
Neural Plate/Tube
Splanchnic Mesoderm
Precardiac Mesoderm
Splanchnic Mesoderm
13-18
stage 15
Central Nervous System
Ear/Otic Placcode
Eye
Lens
Nasal Placcode/Nerve
Neural Plate/Tube
Trigeminal Placode
19-23
stage 19
stage 23
Dermomyotome
Diencephalon
Ear/Otic Placcode
Eye
Hindbrain
Nasal Placcode/Nerve
Neural Plate/Tube
Pharyngeal Arches and Clefts
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.22845

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona