GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

BMP4
bone morphogenetic protein 4

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolBMP4
Official Full Namebone morphogenetic protein 4
CGNC ID49681
also known asBMP-4, bone morphogenetic protein 4, BMP-4, Bone morphogenetic protein 4 precursor
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205237
PolypeptideNP_990568
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.686
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human652ENSG00000125378MIM:607932MIM:112262
Mouse12159ENSMUSG00000021835All phenotypic alleles (16):Targeted, knock-out(3) Targeted, other(13) MGI:88180
Xenopus549788, 397874, 399322483057
Zebrafish30612ENSDARG00000019995ZDB-GENE-980528-2059ZFIN:ZDB-GENE-980528-2059
Gene Ontology
Molecular Functioncytokine activity, growth factor activity
Biological Processbeak morphogenesis, cartilage development, cell differentiation, cell proliferation, cloacal septation, more...embryonic skeletal system morphogenesis, growth, mesenchymal cell proliferation involved in ureter development, mesenchymal cell proliferation involved in ureteric bud development, ossification, positive regulation of epidermal cell differentiation, regulation of cell fate commitment, ureteric bud morphogenesis
Cellular Componentextracellular space
Links to other databases
Entrez Gene396165
Ensembl Gene
KEGGgga:396165

Entry 1

GEISHA IdChEST895j20Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCCAGAATC
ATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTA
TGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGG
GACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTT
TGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCC
GGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCGTGAGGA
GCTTCCACCATGAAGGTCAGTGATGGGAGGAGGGAAATTCCCAGCGCCGGGAGCGCTCGGCGGCTCACCAATGCGTTTG
GGAGCGGGTCGTGCCCGCCTCTTGCTTTTTACGGGAGGAAAAACGCTCCCGACGCGCGCGGTGCGCGGGTGACAGCGTC
TGCCGGGCTGTCCCGCTGCTGTCCCCGCATCCCGCGGCTGTTCCGAGGTGTTGGAGCGCTTCGACGACGCCGTCCGCCG
GTCCCCGTGCCGCGGGGTCGCTCCCGGGCTCGCGTGGGCTTCGTGCATCCGCTGCGGGAGTGAAGGAGGGCGGGAGGTC
GCCCACCCCCGGAGCGTTTCCTTTCACTTCCCAACGATCGCTGCCTGGTTTTGCCC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
Extraembryonic
 
13-18
stage 16
Lateral Plate Mesoderm
Limb Buds
Neural Crest
Proepicardium
 
19-21
stage 21
stage 21
Allantois
Amnion
Ear/Otic Placcode
Eye
Leg AER
Limb Buds
Nasal Placcode/Nerve
Neural Crest
Pharyngeal Arches and Clefts
Somatopleure
Spinal Cord
Wing AER
 

Entry 2

GEISHA IdBMP4.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTTATAAAAGCTTGCGGCCGCAGAATATATGTTTGGGCTGCGAAGGC
Reverse cDNA Template PrimerGCTCTAGAAATTAACCCTCACTAAAGGGCGTGGTTGGTGGAGTTGAGcDNA Template Length860
Complete cDNA Template Probeshow
AATTTATTTTGGGTTGGGGCCACAATCAGCCGATCCCATTACATGCGTGGATCTCTACGGCCCTTCCGGGAGAAAGGAG
GAGAGCCTCCGGAGATCAGCCTGATACCCGGAGGATCGACCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAAG
CACCTGGAGAGCGTGCCGGGTCCCAAAGCGCCGCGATCCGTTCTTTTCAACCTGAGCGTGCCGGACAACGGGTGATCTG
TCGGCGGAGCTGCGCTGTACCGGGATCAGGTGGAGGACCGAGCACGGCGTGGAGAGGGGCTTCCACCGGATAAACATTT
ACAAGTGATGAACCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGA
CGCGCTGGGAGACCTTTGATGTGACCCAGCCGTGATCCGGTGGACCAAGGACAAGCACCCAACCACGGGTGGTGATCAG
GTGACCCACCTCCACCAGGCACAATCATCAGGGAAACACGTCAGGATTAGCCGATTTTACCTCAGGGGCAGGCGGATGG
GCGCATCAGGCCGCTCCTGGTCACCTTCGGGCACACGGGCGAGGCCACCGCTGACCCGCAGGGCCCGCGCAGCCCAGCA
CAGGTTCCCCAAGAACAAAAAAAACTGCCGCCGCACGCTCTCTATGTGGATTTCAGCATCGTGGGTTGACATTGGACGT
GGCCCCCCAGGGCTACGGCGTTTTATCTGCCAGGGGGACTGCCCCTTCCCTTGGCCACAACCTCATCCATAACAGGTCT
TTATGGGGGTTAATTTCAACAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 21
Ear/Otic Placode
Lateral Plate Mesoderm
Leg AER
Leg Mesenchyme
Pharyngeal Arches and Clefts
Proepicardium
Retina
Spinal Cord
Wing AER
Wing Mesenchyme
Sections pending.
25-30
stage 25
stage 25
stage 25
Ear/Otic Placode
Lateral Plate Mesoderm
Leg AER
Liver
Oral Pharynx
Pharyngeal Arches and Clefts
Proepicardium
Somites
Wing AER
 
31-42
stage 42
Feathers/Scutae
Surface Ectoderm
 

Entry 3

GEISHA IdBmp4.Kamimura.2004Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationKamimura, M, Matsumoto, K, Koshiba-Takeuchi, K, Ogura, T. Vertebrate Crossveinless 2 Is Secreted and Acts as an Extracellular Modulator of the BMP Signalling Cascade. Dev Dyn. 2004 Jul;230(3):434-45.
CopyrightWiley-Liss, Inc. 2004
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
stage 17
Neural Plate/Tube
forelimb level
19-24
stage 24
Aorta
dorsal aorta
25-29
stage 29
Surface Ectoderm
Wing Mesenchyme
 

Entry 4

GEISHA IdBmp4.Jensen.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationJensen A. Potential Roles for BMP and Pax Genes in the Development of Iris Smooth Muscle. Dev Dyn. 2005 Feb;232(2):385-92.
CopyrightCopyright © 2005 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-39
stage 31
stage 36
stage 39
Eye
cells at the anterior edge of the iris stroma
rim of the optic cup neuroepithelium,
the ciliary epithelium,

Entry 5

GEISHA IdBmp4.Huillard.2004Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationHuillard E, Marx M. Localized Expression of drm/gremlin in the Central Nervous System of the Chicken Embryo. Dev Dyn. 2004 Mar;229(3):688-94.
CopyrightCopyright © 2004 Wiley-Liss, Inc.
CommentsInsufficient information provided to verify exact probe sequence. Sequence provided is entire coding region from Accession # NM_205237.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 29
Eye
optic nerve head
31-40
stage 36
stage 40
Forebrain
Spinal Cord
cervical level
telencephalic hemispheres

Entry 6

GEISHA IdBmp4.Bastida.2004Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationBastida MF, Delgado MD, Wang B, Fallon JF, Fernandez-Teran M, Ros MA. Levels of Gli3 repressor correlate with Bmp4 expression and apoptosis during limb development. Dev Dyn. 2004 Sep;231(1):148-60. Erratum in: Dev Dyn. 2005 Aug;233(4):1613.
CopyrightWiley-Liss, Inc. 2004
CommentsInsufficient information provided to verify exact probe sequence. Sequence provided is entire coding region from Accession # NM_205237.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-23
stage 23
Wing
anterior forelimb

Entry 7

GEISHA IdBMP4.Chapman.2002Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTC
CitationChapman SC, Schubert FR, Schoenwolf GC, Lumsden A. Analysis of spatial and temporal gene expression patterns in blastula and gastrula stage chick embryos. Dev Biol. 2002 May 1;245(1):187-99.
Copyright2002 Elsevier Science (USA). All rights reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
Ectoderm
Epiblast
Primitive Streak
 

Entry 8

GEISHA IdBmp4.Chapman.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationChapman SC, Cai Q, Bleyl SB, Schoenwolf GC. Restricted expression of Fgf16 within the developing chick inner ear. Dev Dyn. 2006 Aug;235(8):2276-81. PMID: 16786592 [PubMed - indexed for MEDLINE]
CopyrightCopyright © 2006 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19
stage 19
Ear/Otic Placcode
 

Entry 9

GEISHA IdBmp4.Schlueter.2006Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCGGCTCGAGTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGG
GAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGT
CGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGA
TGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCAC
CAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGC
TCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCA
CCAGCGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGAT
TGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACT
CCACCAAGCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGA
GCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAAACTACCAGGAGATGGTGGTGGA
CGGGTGCGGTGC
CommentsAccording to the authors, "a 766 bp partial cDNA clone (ChEST730M5) were identified in the ChickEST Database (Boardman et al., 2002) and obtained from the MRC geneservice." The posted sequence represents the BBSRC read of that est.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 13
stage 13
stage 17
stage 17
Proepicardium
Sinus Venosus
 

Entry 10

GEISHA IdBMP4.Kruithof.2006Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGG
CitationKruithof BP, van Wijk B, Somi S, Kruithof-de Julio M, Pérez Pomares JM, Weesie F, Wessels A, Moorman AF, van den Hoff MJ. BMP and FGF regulate the differentiation of multipotential pericardial mesoderm into the myocardial or epicardial lineage. Dev Biol. 2006 Jul 15;295(2):507-22. Epub 2006 Apr 3.
CopyrightCopyright © 2006 Elsevier B.V. All rights reserved.
CommentsAuthors refer to probe production in another paper which says: "Antisense RNA probes specific for chicken Bmp-4 transcripts were synthesized with T3 RNA polymerase, using BamHI-linearized p6.1 as a template (nucleotides 1-953)." Thus the first 953 nt are shown as the probe.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-16
stage 16
stage 16
stage 16
Proepicardium
 

Entry 11

GEISHA IdBMP4.Ohta.2007Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationOhta S, Suzuki K, Tachibana K, Tanaka H, Yamada G. Cessation of gastrulation is mediated by suppression of epithelial-mesenchymal transition at the ventral ectodermal ridge. Development. 2007 Dec;134(24):4315-24. Epub 2007 Nov 14.
CopyrightPublished by The Company of Biologists 2007. This material is protected by a copyright retained by the authors. Permission granted by Dr. Yamada.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
Tail
Tail Ventral Mesoderm
Ventral Ectodermal Ridge

Entry 12

GEISHA IdBmp4.Bonafede.2006Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationBonafede A, Köhler T, Rodriguez-Niedenführ M, Brand-Saberi B. BMPs restrict the position of premuscle masses in the limb buds by influencing Tcf4 expression. Dev Biol. 2006 Nov 15;299(2):330-44. Epub 2006 Jun 15.
CopyrightCopyright © 2006 Elsevier B.V. All rights reserved.
CommentsThe following probes were used: Sf/Hgf (Thery et al., 1995), qPax3, MyoD and Myf5, Lbx1, Bmp2 and Bmp4, Tcf4. Probes used in this study were kindly provided by Claudio Stern, Gabrielle Kardon, Christophe Marcelle, Bruce M. Paterson, Susanne Dietrich and Paul Brickell. Thus insufficient information provided in publication to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (acc # NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
Wing Mesenchyme
anterior and posterior

Entry 13

GEISHA IdBmp4.Nissim.2006Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGG
CitationNissim S, Hasso SM, Fallon JF, Tabin CJ. Regulation of Gremlin expression in the posterior limb bud. Dev Biol. 2006 Nov 1;299(1):12-21. Epub 2006 May 26.
CopyrightCopyright © 2006 Elsevier B.V. All rights reserved.
CommentsAuthors said: DIG-labeled probes were generated for Gremlin (Capdevila et al., 1999), Shh (Riddle et al., 1993), Bmp2 (Francis et al., 1994), Bmp4 (Francis et al., 1994), and Bmp7 (received from L. Niswander). Francis et al said: Antisense RNA probes specific for chicken Bmp-4 transcripts contained the first 953nt. These were taken from Acc# NM_205237.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
Wing Mesenchyme
 

Entry 14

GEISHA IdBMP4.Sanchez-Calderon.2007Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationSánchez-Calderón H, Francisco-Morcillo J, Martín-Partido G, Hidalgo-Sánchez M (2007). Fgf19 expression patterns in the developing chick inner ear.Gene Expr Patterns. Jan;7(1-2):30-8. Epub 2006 May 19.
CopyrightCopyright © 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 20
stage 24
stage 24
stage 24
stage 24
stage 24
Ear/Otic Placcode
3A10 immunoreaction
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
Ear/Otic Placcode
3A10 immunoreaction

Entry 15

GEISHA IdBmp4.Sanchez-Calderon.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGG
CitationSánchez-Calderón H, Martín-Partido G, Hidalgo-Sánchez M. Pax2 expression patterns in the developing chick inner ear. Gene Expr Patterns. 2005 Aug;5(6):763-73.
CopyrightReprinted with permission from Elsevier. Copyright © 2005 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 20
stage 20
stage 20
stage 20
stage 20
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
Ear/Otic Placcode
Unlabeled
Anterior crista
Basilar papilla
Compares BMP4 with Pax2.
Macula sacculi
Posterior crista
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
Ear/Otic Placcode
Anterior crista
Basilar papilla
Compares BMP4 with Pax2.
Lateral crista
Macula lagena
Macula sacculi
Macula utriculi
Posterior crista

Entry 16

GEISHA IdBMP4.Shigetani.2000Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationShigetani Y, Nobusada Y, Kuratani S. (2000). Ectodermally derived FGF8 defines the maxillomandibular region in the early chick embryo: epithelial-mesenchymal interactions in the specification of the craniofacial ectomesenchyme. Dev Biol. 2000 Dec 1;228(1):73-85.
CopyrightReprinted with permission from Elsevier. Copyright © 2000 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Ectoderm
Pharyngeal Arches and Clefts
 
13-18
stage 13
stage 14
stage 14
stage 18
stage 18
stage 18
Ectoderm
Pharyngeal Arches and Clefts

BMP4 (red)
Fgf8 (brown)
Figure 2 compares expression patterns of Fgf8 and Bmp4 in early chick embryos at HH stages 10, 11-14 and 18.
Mandibular Arch
Maxillary Process
Maxillomandibular Domain

Entry 17

GEISHA IdBMP4.Sakiyama.2000Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationSakiyama J, Yokouchi Y, Kuroiwa A. Coordinated expression of Hoxb genes and signaling molecules during development of the chick respiratory tract. Dev Biol. 2000 Nov 1;227(1):12-27.
CopyrightReprinted with permission from Elsevier. Copyright © 2000 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 24
Lung
Trunk Mesenchyme
Laryngotracheal Groove
25-30
stage 27
stage 29
Lung
 
31-34
stage 34
stage 34
Lung
Figure 3 compares the expressions of Bmp-2 and Bmp-4 in the developing chick respiratory tract at HH stages 20, 24, 27, 29 and 34.

Entry 18

GEISHA IdBMP4.McPherson.2000Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationMcPherson CE, Varley JE, Maxwell GD. Expression and regulation of type I BMP receptors during early avian sympathetic ganglion development. Dev Biol. 2000 May 1;221(1):220-32.
CopyrightReprinted with permission from Elsevier. Copyright © 2000 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237). The images are quail.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 16
stage 17
stage 18
stage 18
Aorta
Dermomyotome
Spinal Ganglia and Nerves
Dorsal Aorta
Figure 4 compares the expressions of Cash-1, BMP-4, BMPR-IA, and BMPR-IB mRNA in stage 16, 17, and 18 quail embryos.
Quail
Sympathetic Ganglia
19-23
stage 23
stage 23
Aorta
Spinal Ganglia and Nerves
Dorsal Aorta
Figure 2 compares the expressions of BMP-4, BMPR-IA, BMPR-IB, and TH mRNAs in stage HH23 quail embryos.
Quail
Sympathetic Ganglia

Entry 19

GEISHA IdBmp4.Bardot.2004Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationBardot B, Lecoin L, Fliniaux I, Huillard E, Marx M, Viallet JP. Drm/Gremlin, a BMP antagonist, defines the interbud region during feather development. Int J Dev Biol. 2004;48(2-3):149-56.
Copyright"Reprinted from Int. J. Dev. Biol., 48, Bardot B, Lecoin L, Fliniaux I, Huillard E, Marx M, Viallet JP, Drm/Gremlin, a BMP antagonist, defines the interbud region during feather development, 149-56, Copyright (2004), with permission from Copyright © 2004 UBC Press". All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc #NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 22
Feathers/Scutae
Wing
 
31-44
stage 44
Feathers/Scutae
Wing
Comparison with other genes

Entry 20

GEISHA IdBmp4.Ashique.2002Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationAshique AM, Fu K, Richman JM. Signalling via type IA and type IB bone morphogenetic protein receptors (BMPR) regulates intramembranous bone formation, chondrogenesis and feather formation in the chicken embryo. Int J Dev Biol. 2002 Mar;46(2):243-53.
Copyright"Reprinted from Int. J. Dev. Biol., 46, Ashique AM, Fu K, Richman JM, Signalling via type IA and type IB bone morphogenetic protein receptors (BMPR) regulates intramembranous bone formation, chondrogenesis and feather formation in the chicken embryo, 243-53, Copyright (2002), with permission from Copyright © 2002 UBC Press". All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 29
Face Mesenchyme
 
31-44
stage 44
Head Mesenchyme
Comparison of different genes
Control panels are A E I L

Entry 21

GEISHA IdBmp4.Christ.2002Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationChrist B, Brand-Saberi B. Limb muscle development. Int J Dev Biol. 2002;46(7):905-14.
Copyright"Reprinted from Int. J. Dev. Biol., 46, Christ B, Brand-Saberi B, Limb muscle development, 905-14, Copyright (2002), with permission from Copyright © 2002 UBC Press". All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc #NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 22
Wing
Comparison with other genes
31-44
stage 44
Wing
Comparison with other genes

Entry 22

GEISHA IdBmp4.Peters.2002Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationPeters MA, Cepko CL (2002). The dorsal-ventral axis of the neural retina is divided into multiple domains of restricted gene expression which exhibit features of lineage compartments. Dev Biol. 2002 Nov 1;251(1):59-73.
Copyright"Reprinted from Developmental Biology, 251(1), Peters MA, Cepko CL, The dorsal-ventral axis of the neural retina is divided into multiple domains of restricted gene expression which exhibit features of lineage compartments, 59-73, Copyright (2002), with permission from Elsevier". Copyright © ( 2002) Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
Retina
double labeled with VAX
19-24
stage 22
Retina
 
31-44
stage 44
stage 44
Retina
 

Entry 23

GEISHA IdBmp4.Chapman.2008Data SourceDirect Submission
Forward cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCTCGGAATTCCAGCTGAGCGCCG
GTCGCTG
CommentsImages Provided by Susan Chapman
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Ectoderm
Epiblast
Primitive Streak
neural margin
7-12
stage 7
stage 8
stage 8
stage 9
stage 9
stage 10
Head Mesenchyme
Hindbrain
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Primitive Streak
neural folds
13-17
stage 17
stage 17
stage 17
stage 17
Eye
Lateral Plate Mesoderm
Pharyngeal Arches and Clefts
 

Entry 24

GEISHA IdBmp4.Holleville.2007Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGG
CitationHolleville N, Matéos S, Bontoux M, Bollerot K, Monsoro-Burq AH. Dlx5 drives Runx2 expression and osteogenic differentiation in developing cranial suture mesenchyme. Dev Biol. 2007 Apr 15;304(2):860-74.
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsAccording to the authors, the probes were like those from Francis et al., 1994, who said: Antisense RNA probes specific for chicken Bmp-4 (used) nucleotides 1-953 (using Acc# NM_205237.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 30
stage 30
Face Mesenchyme
 
31-38
stage 38
stage 38
Face Mesenchyme
 

Entry 25

GEISHA IdBMP4.Honig.2005Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationHonig MG, Camilli SJ, Surineni KM, Knight BK, Hardin HM. The contributions of BMP4, positive guidance cues, and repulsive molecules to cutaneous nerve formation in the chick hindlimb. Dev Biol. 2005 Jun 1;282(1):257-73.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
Wing Mesenchyme
subectodermal mesenchyme
25-26
stage 26
stage 26
Wing Mesenchyme
subectodermal mesenchyme

Entry 26

GEISHA IdBMP4.Zhang.2001Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationZhang XM, Yang XJ (2001). Temporal and spatial effects of Sonic hedgehog signaling in chick eye morphogenesis. Dev Biol. 2001 May 15;233(2):271-90.
CopyrightCopyright © 2001 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 18
Eye
Retina
dorsal retina
ventral pigmented epithelium
19-24
stage 22
stage 22
stage 24
stage 24
stage 24
stage 24
Eye
Retina
dorsal peripheral retina
ventral pigmented epithelium

Entry 27

GEISHA IdBMP4.Jin.2001Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationJin EJ, Erickson CA, Takada S, Burrus LW (2001). Wnt and BMP signaling govern lineage segregation of melanocytes in the avian embryo. Dev Biol. 2001 May 1;233(1):22-37.
CopyrightCopyright © 2001 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13
stage 13
stage 13
Neural Plate/Tube
Dorsal Neural Tube
Melanoblasts

Entry 28

GEISHA IdBMP4.Nielsen.2001Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationNielsen C, Murtaugh LC, Chyung JC, Lassar A, Roberts DJ (2001). Gizzard formation and the role of Bapx1. Dev Biol. 2001 Mar 1;231(1):164-74.
CopyrightCopyright © 2001 Academic Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 30
Gizzard
Gut
Mesodermal Layer

Entry 29

GEISHA IdBMP4.Joubin.1999Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationJoubin K, Stern CD. Molecular interactions continuously define the organizer during the cell movements of gastrulation. Cell. 1999 Sep 3;98(5):559-71.
CopyrightCopyright © 1999 Cell Press. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4
stage 4
Area Pellucida
Epiblast
 

Entry 30

GEISHA IdBMP4.Streit.1999Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationStreit A, Stern CD. Establishment and maintenance of the border of the neural plate in the chick: involvement of FGF and BMP activity. Mech Dev. 1999 Apr;82(1-2):51-66.
CopyrightCopyright © 1999 Elsevier Science Ireland Ltd. All rights reserved
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
Area Pellucida
Epiblast
Neural Plate/Tube
Primitive Streak
 
7-8
stage 8
stage 8
Neural Plate/Tube
Primitive Streak
 

Entry 31

GEISHA IdBMP4.Streit.1998Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationStreit A, Lee KJ, Woo I, Roberts C, Jessell TM, Stern CD. Chordin regulates primitive streak development and the stability of induced neural cells, but is not sufficient for neural induction in the chick embryo. Development. 1998 Feb;125(3):507-19.
CopyrightPrinted in Great Britain © The Company of Biologists Limited 1998 DEV4960
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage XIII
Area Opaca
Area Pellucida
Epiblast
Stage XIII, EG&K
1-3
stage 2
Area Opaca
Epiblast
 
4-6
stage 4
stage 5
Area Pellucida
Neural Plate/Tube
future neural plate
7-8
stage 8
stage 8
Neural Plate/Tube
 

Entry 32

GEISHA IdBMP4.McKinnell.2004Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationMcKinnell IW, Turmaine M, Patel K (2004). Sonic Hedgehog functions by localizing the region of proliferation in early developing feather buds. Dev Biol. 2004 Aug 1;272(1):76-88.
CopyrightCopyright © 2004 Published by Elsevier Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 30
stage 30
Feathers/Scutae
Control

Entry 33

GEISHA IdBMP4.Nimmagadda.2005Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationNimmagadda S, Geetha Loganathan P, Huang R, Scaal M, Schmidt C, Christ B. (2005) BMP4 and noggin control embryonic blood vessel formation by antagonistic regulation of VEGFR-2 (Quek1) expression. Dev Biol. 2005 Apr 1;280(1):100-10.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-15
stage 15
Intermediate Mesoderm
Lateral Plate Mesoderm
 

Entry 34

GEISHA IdBMP4.Holleville.2003Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationHolleville N, Quilhac A, Bontoux M, Monsoro-Burq AH. BMP signals regulate Dlx5 during early avian skull development. Dev Biol. 2003 May 1;257(1):177-89.
CopyrightCopyright © 2003 Elsevier Science (USA) All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-42
stage 35
stage 42
stage 42
Head Mesenchyme
Surface Ectoderm
Dermis
Developing Bone
Mesenchymal Bone Progenitors

Entry 35

GEISHA IdBMP4.Basch.2006Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationBasch ML, Bronner-Fraser M, García-Castro MI. Specification of the neural crest occurs during gastrulation and requires Pax7. Nature. 2006 May 11;441(7090):218-22.
CopyrightCopyright © 2006, Nature Publishing Group
CommentsInsufficient information provided in publication to verify exact sequence to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-5
stage 5
stage 5
Early Embryo
Neural Plate/Tube
 

Entry 36

GEISHA IdBMP4.Ezin.2009Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationEzin AM, Fraser SE, Bronner-Fraser M. Fate map and morphogenesis of presumptive neural crest and dorsal neural tube. Dev Biol. 2009 Jun 15;330(2):221-36. Epub 2009 Mar 28.
CopyrightCopyright © 2009 Published by Elsevier Inc.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
Epiblast
Neural Crest
 
7
stage 7
Epiblast
Neural Crest
 

Entry 37

GEISHA IdBMP4.Garcia-Castro.2002Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationGarcía-Castro MI, Marcelle C, Bronner-Fraser M. Ectodermal Wnt function as a neural crest inducer. Science. 2002 Aug 2;297(5582):848-51.
CopyrightCopyright © 2002, The American Association for the Advancement of Science
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205237.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
Lateral Plate Mesoderm
Neural Crest
Primitive Streak
neural folds

Entry 38

GEISHA IdBMP4.Trimarchi.2009Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationTrimarchi JM, Cho SH, Cepko CL. Identification of genes expressed preferentially in the developing peripheral margin of the optic cup. Dev Dyn. 2009 Sep;238(9):2327-9.
CopyrightDev. Dyn Copyright © 2009 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205237.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
stage 23
Retina
 
25-30
stage 29
Retina
 
31-34
stage 34
Retina
 

Entry 39

GEISHA IdBMP4.Selleck.1998Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationSelleck MA, García-Castro MI, Artinger KB, Bronner-Fraser M., Effects of Shh and Noggin on neural crest formation demonstrate that BMP is required in the neural tube but not ectoderm. Development. 1998 Dec;125(24):4919-30.
CopyrightPublished by The Company of Biologists 2007. This material is protected by a copyright retained by the authors. Permission granted by Dr. Bronner Fraser.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
Neural Plate/Tube
 

Entry 40

GEISHA IdBMP4.Sanchez-Calderon.2004Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationSánchez-Calderón H, Martín-Partido G, Hidalgo-Sánchez M. Otx2, Gbx2, and Fgf8 expression patterns in the chick developing inner ear and their possible roles in otic specification and early innervation. Gene Expr Patterns. 2004 Oct;4(6):659-69.
CopyrightReprinted with permission from Elsevier. Copyright © 2004 Elsevier B.V. All rights reserved.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
Ear/Otic Placode
 
25-27
stage 27
stage 27
stage 27
Ear/Otic Placode
 

Entry 41

GEISHA IdBMP4.Smith.2000Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationSmith DM, Grasty RC, Theodosiou NA, Tabin CJ, Nascone-Yoder NM. Evolutionary relationships between the amphibian, avian, and mammalian stomachs. Evol Dev. 2000 Nov-Dec;2(6):348-59.
CopyrightCopyright © 2000-2011 by John Wiley & Sons, Inc., or related companies. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to suntheisze probe, the sequence below was obtained from NCBI (acc. # NM_205237)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
stage 24
Midgut
Stomach
stage E4.5

Entry 42

GEISHA IdBMP4.Sanchez-Guardado.2011Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAG
CitationSánchez-Guardado LÓ, Ferran JL, Rodríguez-Gallardo L, Puelles L, Hidalgo-Sánchez M. Meis gene expression patterns in the developing chicken inner ear. J Comp Neurol. 2011 Jan 1;519(1):125-47.
Copyright© 2010 Wiley-Liss, Inc.
CommentsThe sequence below was obtained from NCBI (acc. #: NM_205237) using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 20
stage 20
stage 20
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
stage 24
Ear/Otic Placode
Unlabeled
ac, anterior cristae
bp, basilar papilla
bp, basilar papilla; pc, posterior cristae
lc, lateral cristae
ms, macula sacculi
25-27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
stage 27
Ear/Otic Placode
 

Entry 43

GEISHA IdBMP4.Fuchs.2010Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationFuchs A, Inthal A, Herrmann D, Cheng S, Nakatomi M, Peters H, Neubüser A. Regulation of Tbx22 during facial and palatal development. Dev Dyn. 2010 Nov;239(11):2860-74.
Copyright© 2010 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 19
stage 19
stage 23
Face Mesenchyme
Nasal Placode/Nerve
facial ectoderm
25-26
stage 26
Face Mesenchyme
Nasal Placode/Nerve
facial ectoderm

Entry 44

GEISHA IdBMP4.Parkinson.2010Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationParkinson N, Collins MM, Dufresne L, Ryan AK. Expression patterns of hormones, signaling molecules, and transcription factors during adenohypophysis development in the chick embryo. Dev Dyn. 2010 Apr;239(4):1197-210.
CopyrightCopyright © 2010 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237.2).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
stage 23
Diencephalon
Pituitary (Rudiment)
rp, Rathke's pouch
25-29
stage 29
Diencephalon
Pituitary (Rudiment)
rp, Rathke's pouch

Entry 45

GEISHA IdBMP4.Halilagic.2007Data SourcePublication
Complete cDNA Template Probeshow
CCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGCTCTCC
AGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGGTCATC
CTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGC
TTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTGCTGCA
GATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACCGGCTC
CAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAACACCG
TGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAA
CCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGC
GCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTA
CGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCG
GTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCAGGGC
AAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCT
TCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGAACAA
AAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGC
TACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATCGTGC
AGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCT
CTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCC
CTTCCCTCCCCTCCCCTCCTCT
CitationHalilagic A, Ribes V, Ghyselinck NB, Zile MH, Dollé P, Studer M. Retinoids control anterior and dorsal properties in the developing forebrain. Dev Bio 2007 Mar 1;303(1):244-58
CopyrightReprinted with permission from Elsevier. Copyright © 2007 Elsevier B.V. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237.2). Images are quail, but sequence and map shown are chick.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 14
Retina
quail embryo
19
stage 19
stage 19
stage 19
stage 19
Eye
Forebrain
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
Retina
quail embryo

Entry 46

GEISHA IdBMP4.Maier.2010Data SourcePublication
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGGAGCCTCCAGGAGATCAGCCTGC
AGTACCCGGAGCGATCTGCCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGG
TCCCAGCGAAGCGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGAGGAG
CTGCGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAG
TGATGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCG
CTGGGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAG
GTGACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCG
GGGACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCG
CCGCAGCCCCAAGCACCACGGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGAC
GTGGGTTGGAACGATTGGATCGTGGCCCCCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGG
CCGACCACCTCAACTCCACCAACCACGCCATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTG
CTGCGTGCCCACGGAGCTGAGCGCCATCTCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAG
GAGATGGTGGTGGAGGGGTGCGGGTGCCGCTGACCCCTTCCCTCCCCTCCCCTCCTCT
CitationMaier, E, von Hofsten, J, Nord, H, Fernandes, M, Paek, H, Hebert, JM, Gunhaga, L, Opposing Fgf and Bmp activities regulate the specification of olfactory sensory and respiratory epithelial cell fates. Development. 2010 May 15; 137(10): 1601–1611.
CopyrightCopyright © 2010. Held by the authors. Requested
CommentsAccession number listed has been removed byNCBI. As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 14
stage 14
Nasal Placode/Nerve
Surface Ectoderm
Unlabeled
 
19-22
stage 22
stage 22
stage 22
Nasal Placode/Nerve
Surface Ectoderm
 

Entry 47

GEISHA IdBMP4.Bothe.2011Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationBothe I, Tenin G, Oseni A, Dietrich S., Dynamic control of head mesoderm patterning., Development. 2011 Jul;138(13):2807-21.
CopyrightPermission from the authors and the Company of Biologists Ltd. Copyright held by the authors.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
stage 5
stage 6
Neural Crest
Surface Ectoderm
 
7-12
stage 9
Ear/Otic Placode
Surface Ectoderm
 
13
stage 13
Ear/Otic Placode
Eye
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
 

Entry 48

GEISHA IdBMP4.Carré.2011Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationCarré GA, Couty I, Hennequet-Antier C, Govoroun MS. Gene expression profiling reveals new potential players of gonad differentiation in the chicken embryo. PLoS One. 2011;6(9):e23959. Epub 2011 Sep 9.
CopyrightCreative Commons: http://creativecommons.org/licenses/by/2.5/
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237.3 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-36
stage 36
stage 36
stage 36
stage 36
Gonad
female
male

Entry 49

GEISHA IdBMP4.Huber.2008Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationHuber K, Franke A, Brühl B, Krispin S, Ernsberger U, Schober A, von Bohlen und Halbach O, Rohrer H, Kalcheim C, Unsicker K. Persistent expression of BMP-4 in embryonic chick adrenal cortical cells and its role in chromaffin cell development. Neural Dev. 2008 Oct 22;3:28.
Copyright© 2008 Huber et al; licensee BioMed Central Ltd. (requested from Dr. Unsicker)
CommentsThe probe was amplified by PCR using the following primers: 5'AGGAGCTTCCACCATGAAGA3' and 5'CGGCTAATCCTGACGTGTTT3' and was extracted from NCBI Acc# NM_205237.3.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 21
stage 21
stage 23
Aorta
Intermediate Mesoderm
 
25-30
stage 26
stage 30
Aorta
Intermediate Mesoderm
 
31-35
stage 35
stage 35
stage 35
Aorta
Intermediate Mesoderm
double labeled

Entry 50

GEISHA IdBMP4.Grevellec.2011Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationGrevellec A, Graham A, Tucker AS. Shh signalling restricts the expression of Gcm2 and controls the position of the developing parathyroids. Dev Biol. 2011 May 15;353(2):194-205. Epub 2011 Feb 22.
CopyrightCopyright © 2011 Elsevier Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI (acc # NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 22
stage 22
stage 24
stage 24
Pharyngeal Arches and Clefts
 

Entry 51

GEISHA IdBMP4.LeDréau.2012Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationLe Dréau G, Garcia-Campmany L, Rabadán MA, Ferronha T, Tozer S, Briscoe J, Martí E. Canonical BMP7 activity is required for the generation of discrete neuronal populations in the dorsal spinal cord. Development. 2012 Jan;139(2):259-68.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 14
stage 14
stage 18
Neural Plate/Tube
roof plate
19-24
stage 24
Neural Plate/Tube
roof plate

Entry 52

GEISHA IdBMP4.Stuhlmiller.2012Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationStuhlmiller TJ, García-Castro MI. FGF/MAPK signaling is required in the gastrula epiblast for avian neural crest induction. Development. 2012 Jan;139(2):289-300.
Copyright© 2012. Published by The Company of Biologists Ltd
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-5
stage 5
stage 5
Epiblast
Primitive Streak
 

Entry 53

GEISHA IdBMP4.Battisti.2008Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationBattisti AC, Fekete DM. Slits and Robos in the developing chicken inner ear. Dev Dyn. 2008 Feb;237(2):476-84.
CopyrightCopyright © 2008 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (acc # NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
stage 23
Ear/Otic Placode
AC, anterior crista
P, posterior Bmp4-positive focus
SM, saccular macula
25-27
stage 27
Ear/Otic Placode
BP, basilar papilla
SM, saccular macula

Entry 54

GEISHA IdBMP4.Brito.2006Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationJosé M. Brito, Marie-Aimée Teillet, Nicole M. Le Douarin. An early role for Sonic hedgehog from foregut endoderm in jaw development: Ensuring neural crest cell survival. Proc Natl Acad Sci U S A. 2006 August 1; 103(31): 11607–11612.
CopyrightCopyright © 2006 by The National Academy of Sciences of the USA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-21
stage 21
stage 21
Ectoderm
Oral Pharynx
 

Entry 55

GEISHA IdBMP4.Gamer.2008Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationGamer LW, Ho V, Cox K, Rosen V.. Expression and Function of BMP3 During Chick Limb Development. Dev Dyn. 2008 June; 237(6): 1691–1698.
CopyrightCopyright © 2008 Wiley-Liss, Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
stage 24
Leg AER
 

Entry 56

GEISHA IdBMP4.Ishii.2010Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationIshii Y, Garriock RJ, Navetta AM, Coughlin LE, Mikawa T.. BMP Signals Promote Proepicardial Protrusion Necessary for Recruitment of Coronary Vessel and Epicardial Progenitors to the Heart. Dev Cell. 2010 August 17; 19(2): 307–316.
CopyrightCopyright © 2010 Elsevier Inc. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237.3 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
Unlabeled
Heart shown

Entry 57

GEISHA IdBMP4.AhnfeltRonne.2010Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationJonas Ahnfelt-Rønne, Philippe Ravassard, Corinne Pardanaud-Glavieux, Raphaél Scharfmann, Palle Serup. Mesenchymal Bone Morphogenetic Protein Signaling Is Required for Normal Pancreas Development. Diabetes. 2010 August; 59(8): 1948–1956.
CopyrightCopyright © 2010 by the American Diabetes Association.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205237.3 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
stage 18
Pancreas
Stomach
 

Entry 58

GEISHA IdBMP4.Houghton.2005Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationHoughton L, Lindon C, Morgan BA. The ectodysplasin pathway in feather tract development. Development. 2005 Mar;132(5):863-72. Epub 2005 Jan 26.
Copyrightcopyright is held by the authors. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237.3 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-34
stage 31
stage 31
stage 34
stage 34
Feathers/Scutae
 

Entry 59

GEISHA IdBMP4.Chang.2004Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationChang W, Brigande JV, Fekete DM, Wu DK. The development of semicircular canals in the inner ear: role of FGFs in sensory cristae. Development. 2004 Sep;131(18):4425-34. Epub 2004 Aug 11.
CopyrightCopyright is held by the authors. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205237.3 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-21
stage 21
stage 21
Ear/Otic Placode
 

Entry 60

GEISHA IdBMP4.Wood.2010Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationWood JL, Hughes AJ, Mercer KJ, Chapman SC. Analysis of chick (Gallus gallus) middle ear columella formation. BMC Dev Biol. 2010; 10: 16. Published online 2010 February 16.
CopyrightCopyright ©2010 Wood et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237.3 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 26
stage 28
Face Mesenchyme
 
31-34
stage 31
stage 34
stage 34
stage 34
Face Mesenchyme
Surface Ectoderm
 

Entry 61

GEISHA IdBMP4.Daudet.2007Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationDaudet N, Ariza-McNaughton L, Lewis J. Notch signalling is needed to maintain, but not to initiate, the formation of prosensory patches in the chick inner ear. Development. 2007 Jun;134(12):2369-78.
CopyrightCopyright 2007 the authors. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_205237.3 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
Ear/Otic Placode
Surface Ectoderm
 
25-30
stage 26
Ear/Otic Placode
 
31
stage 31
stage 31
Ear/Otic Placode
 

Entry 62

GEISHA IdBMP4.Katsu.2012Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationKatsu K, Tokumori D, Tatsumi N, Suzuki A, Yokouchi Y. BMP inhibition by DAN in Hensen's node is a critical step for the establishment of left-right asymmetry in the chick embryo. Dev Biol. 2012 Mar 1;363(1):15-26.
CopyrightCopyright © 2012. Published by Elsevier Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 6
stage 6
Hensen's Node
Lateral Plate Mesoderm
 

Entry 63

GEISHA IdBMP4.Wade.2012Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationWade C, Brinas I, Welfare M, Wicking C, Farlie PG. Twist2 contributes to termination of limb bud outgrowth and patterning through direct regulation of Grem1. Dev Biol. 2012 Oct 1;370(1):145-53.
CopyrightCopyright © 2012 Elsevier Inc. All rights reserved
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc # NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25
stage 25
stage 25
stage 25
Leg
Left side: control hindlimb; Right side: 48 hours post-infection
Left side: control hindlimb; Right side: 72 hours post-infection

Entry 64

GEISHA IdBMP4.Mercader.2000Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationMercader N, Leonardo E, Piedra ME, Martínez-A C, Ros MA, Torres M. Opposing RA and FGF signals control proximodistal vertebrate limb development through regulation of Meis genes. Development. 2000 Sep;127(18):3961-70.
Copyright© The Company of Biologists Limited 2000
CommentsAccording to the authors, "Riboprobes cBmp2, cBmp4 and cBmp7 were kindly provided by C. Tabin and B. Houston." As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence was obtained from NCBI (acc# NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
stage 22
Limb Buds
left side = control side
right side = FGF1 bead

Entry 65

GEISHA IdBMP4.Pernaute.2010Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationPernaute B, Cañon S, Crespo M, Fernandez-Tresguerres B, Rayon T, Manzanares M. Comparison of extraembryonic expression of Eomes and Cdx2 in pregastrulation chick and mouse embryo unveils regulatory changes along evolution. Dev Dyn. 2010 Feb;239(2):620-9. doi: 10.1002/dvdy.22176.
CopyrightCopyright © 2009 Wiley-Liss, Inc.
CommentsAccording to the authors, "The probe for chick Bmp4 was a gift from Dr. J.J. Sanz-Ezquerro". As information provided was insufficient to verify exact sequence used to synthesize probe, the sequence was obtained from NCBI (acc# NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage XI
Unlabeled
 
1-3
stage 1
  
4
stage 4
Epiblast
 

Entry 66

GEISHA IdBMP4.Sánchez-Guardado.2009Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationSánchez-Guardado LO, Ferran JL, Mijares J, Puelles L, Rodríguez-Gallardo L, Hidalgo-Sánchez M. Raldh3 gene expression pattern in the developing chicken inner ear. J Comp Neurol. 2009 May 1;514(1):49-65. doi: 10.1002/cne.21984.
CopyrightCopyright © 1999–2013 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_205237.3
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 21
stage 21
stage 24
stage 24
stage 24
Ear/Otic Placode
 
25-27
stage 27
stage 27
stage 27
Ear/Otic Placode
 

Entry 67

GEISHA IdBMP4.BrennerAnantharam.2007Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationBrenner-Anantharam A, Cebrian C, Guillaume R, Hurtado R, Sun TT, Herzlinger D. Tailbud-derived mesenchyme promotes urinary tract segmentation via BMP4 signaling. Development. 2007 May;134(10):1967-75. Epub 2007 Apr 18.
CopyrightCopyright held by the authors. Published by the Company of Biologists Ltd.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_205237.3
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 21
stage 21
stage 21
stage 21
stage 21
Allantois
Lateral Plate Mesoderm
Metanephros
Renal
Tail
 
31-40
stage 40
stage 40
stage 40
Glomeruli
Nephric Tubules
 

Entry 68

GEISHA IdBMP4.Tzahor.2003Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCCCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTCT
TCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGCC
GAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGCC
ATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTGA
TCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATCA
GGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGTC
ACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAGA
ACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCCC
GGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCATC
GTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCCA
TGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCTG
ACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTAA
ACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTTT
GACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationTzahor E, Kempf H, Mootoosamy RC, Poon AC, Abzhanov A, Tabin CJ, Dietrich S, Lassar AB. Antagonists of Wnt and BMP signaling promote the formation of vertebrate head muscle. Genes Dev. 2003 Dec 15;17(24):3087-99.
CommentsAs insufficient information is provided in publication to verify the exact sequence used to synthesize probe, the sequence was obtained from NCBI (acc #NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-17
stage 17
stage 17
stage 17
Pharyngeal Arches and Clefts
 

Entry 69

GEISHA IdBMP4.Zou.1997Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGT
ACCCGGAGCGATCGACCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCC
CAGCGAAGTGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTG
CGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGA
TGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTG
GGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTG
ACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGG
ACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCG
CAGCCCCAAGCACCAGCGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTG
GG
CitationZou H, Wieser R, Massagué J, Niswander L. Distinct roles of type I bone morphogenetic protein receptors in the formation and differentiation of cartilage. Genes Dev 1997 Sep 1;11(17):2191-203.
CopyrightCopyright © 1997, Cold Spring Harbor Laboratory Press
CommentsThe complete cDNA template sequence was obtained from the information provided in the publication as described in Zou et al. 1997.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-44
stage 31
stage 44
Leg Bones
metatarsals

Entry 70

GEISHA IdBmp4.Abzhanov.2004Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationAbzhanov A, Tabin CJ. Shh and Fgf8 act synergistically to drive cartilage outgrowth during cranial development. Dev Biol 2004 Sep 1;273(1):134-48.
CopyrightCopyright © 2004 Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (acc # NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-36
stage 36
stage 36
stage 36
Face Mesenchyme
distal mesenchyme of upper and lower jaws

Entry 71

GEISHA IdBMP4.Zou.1996Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
ATGATTCCTGGTAACCGAATGCTGATGGTCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGA
TCCCCGAGACCGGCAGGAAGAAAGTCGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGA
ACTCTTGCGGGGTTTCGAAACGACTCTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTC
ATCCCCAGTTACATGCTGGATCTCTACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGT
ACCCGGAGCGATCGACCAGCCGGGCCAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCC
CAGCGAAGTGCCGCGGATCCGCTTCGTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTG
CGGCTGTACCGGGAGCAGGTGGAGGAGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGA
TGAAGCCGCTGTCGGAGCGCTCGCAGGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTG
GGAGACCTTTGATGTGAGCCCAGCCGTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTG
ACCCACCTCCACCAGGCACAGACTCATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGG
ACTGGGCGCAGCTCAGGCCGCTCCTGGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCG
CAGCCCCAAGCACCAGCGTTCCCGCAAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTG
GG
CommentsThe sequence below was obtained from NCBI (Acc # NM_205237.3 ) using the information provided in the publication as described in Zou et al.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 22
Leg AER
Wing AER
 
25-30
stage 25
stage 28
Leg AER
Wing AER
left limb in the image is from a chick; right limb in the image is from a duck
31-32
stage 31
stage 32
Leg
Leg Mesenchyme
dnBMPR infected limb on right side of image at stage 32; control limb on the left side of the image at stage 15
left limb in the image is from a chick; right limb in the image is from a duck

Entry 72

GEISHA IdBMP4.Li.2004Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationLi H, Liu H, Sage C, Huang M, Chen ZY, Heller S. Islet-1 expression in the developing chicken inner ear. J Comp Neurol. 2004 Sep 6;477(1):1-10
CopyrightCopyright © 1999 - 2018 John Wiley & Sons, Inc. All Rights Reserved
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (Acc. # NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 24
Ear/Otic Placode
vestibular system
25
stage 25
Ear/Otic Placode
basilar papilla

Entry 73

GEISHA IdBMP‐4.Belecky-Adams.2001Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationBelecky-Adams T, Adler R. Developmental expression patterns of bone morphogenetic proteins, receptors, and binding proteins in the chick retina. J Comp Neurol. 2001 Feb 19;430(4):562-72.
CopyrightCopyright © 2001 Wiley‐Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 18
stage 18
Retina
 
31-44
stage 44
  

Entry 74

GEISHA IdBmp‐4.Barlow.1999Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationBarlow AJ, Bogardi JP, Ladher R, Francis-West PH. Expression of chick Barx-1 and its differential regulation by FGF-8 and BMP signaling in the maxillary primordia. Dev Dyn. 1999 Apr;214(4):291-302.
CopyrightCopyright © 1999 Wiley‐Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 23
Ectoderm
 
31-44
stage 44
  

Entry 75

GEISHA IdBMP4.Kiernan.1997Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationKiernan AE, Nunes F, Wu DK, Fekete DM. The expression domain of two related homeobox genes defines a compartment in the chicken inner ear that may be involved in semicircular canal formation. Dev Biol. 1997 Nov 15;191(2):215-29.
CopyrightCopyright q 1997 by Academic Press.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 19
stage 19
stage 23
stage 23
stage 24
Ear/Otic Placode
 
25-30
stage 30
Ear/Otic Placode
 
31-44
stage 44
stage 44
stage 44
  

Entry 76

GEISHA IdBMP4.Sela-Donenfeld.2002Data SourcePublication
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationSela-Donenfeld D, Kalcheim C. Localized BMP4-noggin interactions generate the dynamic patterning of noggin expression in somites. Dev Biol. 2002 Jun 15;246(2):311-28.
CopyrightCopyright © 2002 Elsevier Science (USA).
CommentsThe complete cDNA template sequence was obtained from the information in the publication as described in Sela-Donenfeld et al. 2002.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Somites
 
13-18
stage 17
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
 
31-44
stage 44
  

Entry 77

GEISHA IdBMP4.Anderson.2020Data SourceDirect Submission
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CommentsImages provided by Claire Anderson. As insufficient information was provided to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
stage 12
stage 12
stage 12
stage 12
stage 12
Anterior Intestinal Portal
Dermomyotome
Ear/Otic Placode
Ectoderm
Endoderm
Eye
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Mesencephalon
Midbrain
Neural Plate/Tube
Notochord
Outflow Tract
Pharyngeal Arches and Clefts
Pharynx
Splanchnic Mesoderm
Surface Ectoderm
Yolk Sack or Stalk
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
Images Provided by Claire Anderson; Related article: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
dorsal myocardium
rostral dorsal mesocardium
rostral dorsal myocardium
stomatodaeum

Entry 78

GEISHA IdBMP4.Liem.1995Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
CTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCTGGC
TCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGATGG
TCATCCTACTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGTCGC
AGAGCTTCAGGGACAAGCCGGATCCGGACGCCGCTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACTCTG
CTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCTACC
GGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGCCAA
CACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGTGCCGCGGATCCGCTTCGTC
TTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGGAGC
CGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCAGGC
CATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCCGTG
ATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTCATC
AGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGTACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCTGGT
CACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGCAAG
AACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCCCCC
CGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGCCAT
CGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATCTCC
ATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCCGCT
GACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCTCTA
AACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATATTT
TGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAA
CitationLiem Jr., K.F, Tremml G, Roelink H, Jessell T.M. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell. 1995; 82: 969-979.
CommentsAs insufficient information was provided to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205237.3).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
stage 10
stage 10
Ectoderm
Neural Plate/Tube
epidermal ectoderm
overlying midline ectoderm
prospective forebrain
all
 
  

Entry 79

GEISHA IdBMP4.Brown.2005Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCACTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCT
GGCTCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGA
TGGTCATCCTATTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGT
CGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCACTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACT
CTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCT
ACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGC
CAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTC
GTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGG
AGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCA
GGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCC
GTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTC
ATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCT
GGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGC
AAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCC
CCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGC
CATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATC
TCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCC
GCTGACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCT
CTAAACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATA
TTTTGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAAAATGAGTCATTATTTTAAAGGTAAA
CitationStephen T Brown 1, Juemei Wang, Andrew K Groves. Dlx gene expression during chick inner ear development. J Comp Neurol. 2005 Feb 28;483(1):48-65.0
Copyright© 2005 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence was obtained from NCBI accession number: NM_205237.4.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-30
stage 30
stage 30
stage 30
Ear/Otic Placode
lc, lateral crista; ut, utricular macula
pc, posterior crista
sc, superior crista
all
 
  

Entry 80

GEISHA IdBMP4.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
GCACTGCGCCCGGGCGGCGATCGCGGGAGGCGCTCGGCAGCCGCTGCCCCGGAGGCTTTCGGCGCGCTGGGTCCGCGCT
GGCTCTCCAGAATCATGGACTGTGCTGATATGCCTTGCTTGCTGTCAAGACACCATGATTCCTGGTAACCGAATGCTGA
TGGTCATCCTATTATGCCAAGTCCTGCTGGGAGGTACCAACCATGCTAGCCTGATCCCCGAGACCGGCAGGAAGAAAGT
CGCAGAGCTTCAGGGACAAGCCGGATCCGGACGCCACTCTGCCCAAAGCCATGAACTCTTGCGGGGTTTCGAAACGACT
CTGCTGCAGATGTTTGGGCTGCGAAGGCGGCCCCAGCCCAGCAAATCAGCCGTCATCCCCAGTTACATGCTGGATCTCT
ACCGGCTCCAGTCCGGAGAAGAGGAGGAGAGCCTCCAGGAGATCAGCCTGCAGTACCCGGAGCGATCGACCAGCCGGGC
CAACACCGTGAGGAGCTTCCACCATGAAGAGCACCTGGAGAGCGTGCCGGGTCCCAGCGAAGCGCCGCGGATCCGCTTC
GTCTTCAACCTCAGCAGCGTGCCGGACAACGAGGTGATCTCGTCGGCGGAGCTGCGGCTGTACCGGGAGCAGGTGGAGG
AGCCGAGCGCGGCGTGGGAGAGGGGCTTCCACCGGATAAACATTTACGAAGTGATGAAGCCGCTGTCGGAGCGCTCGCA
GGCCATTACGCGCCTGTTGGACACGCGGTTGGTGCACCACAACGTGACGCGCTGGGAGACCTTTGATGTGAGCCCAGCC
GTGATCCGGTGGACCAAGGACAAGCAGCCCAACCACGGGCTGGTGATCGAGGTGACCCACCTCCACCAGGCACAGACTC
ATCAGGGCAAACACGTCAGGATTAGCCGATCTTTACCTCAGGGGCACGGCGGGGACTGGGCGCAGCTCAGGCCGCTCCT
GGTCACCTTCGGGCACGACGGGCGAGGCCACGCGCTGACCCGCAGGGCCCGCCGCAGCCCCAAGCACCAGCGTTCCCGC
AAGAACAAAAAAAACTGCCGCCGCCACGCTCTCTATGTGGATTTCAGCGACGTGGGTTGGAACGATTGGATCGTGGCCC
CCCCGGGCTACCAGGCGTTTTACTGCCACGGGGACTGCCCCTTCCCTCTGGCCGACCACCTCAACTCCACCAACCACGC
CATCGTGCAGACGTTGGTCAACTCCGTCAACTCCAGCATCCCCAAGGCCTGCTGCGTGCCCACGGAGCTGAGCGCCATC
TCCATGCTCTACCTGGATGAGTATGACAAGGTGGTGCTGAAAAACTACCAGGAGATGGTGGTGGAGGGGTGCGGGTGCC
GCTGACCCCTTCCCTCCCCTCCCCTCCTCTCTCCCTCCCGTCCCACCCCAGAACTGCTTGCTCTAGCTGGACTCTTCCT
CTAAACTAAACGTTCACCTTGACCTTATTTATGACTTTATGTGCAAATGTTTTTTTTTTTTGACAATAATGATCATATA
TTTTGACAAAATATATTTATAACTACGTATTAAAAGAGAAAAAAATAAAATGAGTCATTATTTTAAAGGTAAA
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_205237).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.686

Mouse

EmageMGI:88180
EurexpressMGI:88180
MGI GXDMGI:88180

Frog

Xenbase483057

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980528-2059
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona