GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CBFA2T2
CBFA2/RUNX1 translocation partner 2

Gene
Official SymbolCBFA2T2
Official Full NameCBFA2/RUNX1 translocation partner 2
CGNC ID2242
also known asMTGR1, protein CBFA2T2|core-binding factor, runt domain, alpha subunit 2; translocated to, 2|myeloid translocation gene-related protein 1
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001011689
PolypeptideNP_001011689
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.22987
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human9139ENSG00000078699MIM:603672
Mouse12396ENSMUSG00000038533All phenotypic alleles (3):Targeted, knock-out(1) Targeted, other(2) MGI:1333833
Xenopus100124871, 379213950033
Zebrafish767652ZDB-GENE-070209-1ZFIN:ZDB-GENE-070209-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene419155
Ensembl GeneENSGALG00000003096
KEGGgga:419155

Entry 1

GEISHA IdCBFA2T2Data SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGGCTCGGTTTGAATGGAGGTTAC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGCAGGACAATGAATGGAACGGGcDNA Template Length
Complete cDNA Template Probeshow
GGCTCGGTTTGAATGGAGGTTACCAGGATGAGTTGGTGGACCACCGCCTGACAGAGAGGGAGTGGGCTGACGAGTGGAA
GCACCTCGATCATGCTCTGAACTGCATCATGGAGATGGTGGAGAAGACCCGGCGCTCCATGGCCGTGCTGCGGCGCTGC
CAGGAGGCCGACCGTGAGGAGCTCAACTACTGGAAGAGGCGGTGCAGTGAGGCTGAGCCCCGCAAGGCGGGGGGGGAGT
TGGGCACAGCCCGGCACAGCCCCGGCAGCTCCGACTCCATCGGCAGCGATTCACTGCGGGAGTTCAGCAGCAGGTCGGG
GCCGGGCTACGTCACTGAGGAGATATGGAAGAAAGCAGAAGAAGCCGTGAACGAGGTGAAGCGCCAGGCCATGTCGGAG
GTGCAGAAGGCCGTGGCAGAGGCAGAGCAGAAGGCGTTTGAGATGATCGCCTCCGAGAGGGCGCGCATGGAGCAGACCA
TCGCCGACGCCAAGCGTCAGGCCACCGAGGATGCTTTCCTGGTGATCAACGAGCAGGAGGAGTCCACGGAGAGCTGCTG
GAACTGCGGCCGTAAGGCCAGTGAGACGTGCAGCGGCTGCAACATCGCGCGCTACTGCGGCTCCTTCTGCCAGCACAAG
GACTGGGAGAGGCACCACCGCATCTGCGGGCAGAGCCTGCACGGCCACAGCAAGGGGCTGGCACTGCCTGCGGGGCGCT
CGGCCAAGGGCATGGATGGCGTGCCCAGCCCCAGCATGGAGAAGAGCTCGGCAGCCACCTCCCGCTCCTCCACGCCCGC
ATTTGTGACAGCGATAGACACGAACGGACTCTAAGGGGGAAGTTTGGGTTCAGCCCGTTCCATTCATTGTCCTG
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 6
stage 6
Early Mesoderm
Notochord
Primitive Streak
primitive groove
7-12
stage 8
stage 8
stage 10
stage 11
stage 11
stage 11
stage 11
Anterior Neuropore
Blood Islands
Dermatome
Dermomyotome
Endoderm
Forebrain
Foregut
Head Mesenchyme
Heart Tube
Intermediate Mesoderm
Lateral Plate Mesoderm
Mesoderm
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Primitive Streak
Sinus Venosus
Somites
Splanchnic Mesoderm
extraembryonic mesoderm
 
13-18
stage 16
stage 16
stage 16
stage 16
Dermomyotome
Diencephalon
Foregut
Head Mesenchyme
Neural Plate/Tube
Notochord
Pharyngeal Arches and Clefts
Sclerotome
Sinus Venosus
Somites
Spinal Ganglia and Nerves
ventral mesemtery
19-24
stage 21
stage 21
stage 21
stage 21
stage 22
Ear/Otic Placode
Foregut
Head Mesenchyme
Hindbrain
Hindgut
Leg Mesenchyme
Lung
Mesonephros
Nasal Placode/Nerve
Neural Plate/Tube
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Spinal Cord
Spinal Ganglia and Nerves
Wing Mesenchyme
 
25-26
stage 26
stage 26
stage 26
stage 26
Dermomyotome
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Lung
Midbrain
Nasal Placode/Nerve
Outflow Tract
Pharyngeal Arches and Clefts
Sclerotome
Sinus Venosus
Spinal Cord
Spinal Ganglia and Nerves
Wing Mesenchyme
 

Entry 2

GEISHA IdMTGR1.Koyano-Nakagawa.2005Data SourcePublication
Complete cDNA Template Probeshow
GATCCGGGTACCATGGGCGCCGGGAGCGGGAGGCGGCGAGGAGCCGTGCGATGGTGGGGATCTCGGGAGGCTGCCAGTT
TGCTGGTGAGAAGAGGGTGCCAGTGATGCCCGGCTCGCCCGTGGAAGTGAAGATACAGACCAGGTCCTCTCCTCCCAAC
ATGCCACCACTGCCCCCCGTCAACCCCGGCGGCCCCCGGCCCGTCTCCTTCACCCCAACTGCACTGCCCAACGGGATGA
ACCATTCCCCCCCAACGCTCAACGGGGCACCGTCCCCACCCCAGCGCTTTGGCAACGGCCCGGCCTCCTCCTCCTCTTC
CTCACTGACCAACCAGCAGCTCCCGGCCACGTGCGGTGCGCGGCAGCTCAGCAAGCTGAAACGCTTCCTCACCACCCTG
CAGCAGTTTGGCAATGACATCTCTCCGGAGATCGGGGAGAAGGTGCGGACCCTGGTCCTGGCCCTGGTGAACTCAACAG
TGACGATTGAGGAATTTCACTGCAAGCTGCAAGAGGCGACGAACTTCCCCCTGCGGCCCTTTGTGATCCCCTTCCTGAA
GGCCAACCTCCCTCTGCTCCAGAGAGAGCTGCTGCACTGCGCCCGGGCTGCCAAGCAGACACCATCCCAGTACCTGGCC
CAGCATGAGCACATCCTTCTCAACACCACCTCCTCCCCAGCCGACTCCTCGGAGCTGCTCATTGAGGTCAACGGGAACG
GCAAGAGGCACAGCCCTGACAGAAGGGATGATAACAGCTTCGAGAGGGAGCCGCTGCCGACGGAGCCGCCGGCCAAGCG
TGTGTGCACCATCAGCCCTGCGCCCCGGCACAGCCCAGCACTCAGCATCCCAATGCTGAACCCCGGCGGGCAGTTCCAC
CCCACCCCACCACCCCTCCAGCACTACACCCTGGAAGACATCGCCACCTCCCATCTGTACAGAGACCCCGGCAAGATGC
TGGAGCACAGGGAGATCCGGGACAGGCACGGCGGGCTCGGTTTGAATGGAGGTTACCAGGATGAGTTGGTGGACCACCG
CCTGACAGAGAGGGAGTGGGCTGACGAGTGGAAGCACCTCGATCATGCTCTGAACTGCATCATGGAGATGGTGGAGAAG
ACCCGGCGCTCCATGGCCGTGCTGCGGCGCTGCCAGGAGGCCGACCGTGAGGAGCTCAACTACTGGAAGAGGCGGTGCA
GTGAGGCTGAGCCCCGCAAGGCGGGGGGGGAGTTGGGCACAGCCCGGCACAGCCCCGGCAGCTCCGACTCCATCGGCAG
CGATTCACTGCGGGAGTTCAGCAGCAGGTCGGGGCCGGGCTACGTCACTGAGGAGATATGGAAGAAAGCAGAAGAAGCC
GTGAACGAGGTGAAGCGCCAGGCCATGTCGGAGGTGCAGAAGGCCGTGGCAGAGGCAGAGCAGAAGGCGTTTGAGATGA
TCGCCTCCGAGAGGGCGCGCATGGAGCAGACCATCGCCGACGCCAAGCGTCAGGCCACCGAGGATGCTTTCCTGGTGAT
CAACGAGCAGGAGGAGTCCACGGAGAGCTGCTGGAACTGCGGCCGTAAGGCCAGTGAGACGTGCAGCGGCTGCAACATC
GCGCGCTACTGCGGCTCCTTCTGCCAGCACAAGGACTGGGAGAGGCACCACCGCATCTGCGGGCAGAGCCTGCACGGCC
ACAGCAAGGGGCTGGCACTGCCTGCGGGGCGCTCGGCCAAGGGCATGGATGGCGTGCCCAGCCCCAGCATGGAGAAGAG
CTCGGCAGCCACCTCCCGCTCCTCCACGCCCGCATTTGTGACAGCGATAGACACGAACGGACTCTAAGGGGGAAGTTTG
GGTTCAGCCCGTTCCATTCATTGTCCTGGTGGTGTTTTTTGTTTTTGAAGTCGGAAAATAAAACCCCCAGGAACTCCTA
AAAAAAAAAAAAAAAAAAAA
CitationKoyano-Nakagawa N, Kintner C. The expression and function of MTG/ETO family proteins during neurogenesis. Dev Biol. 2005 Feb 1;278(1):22-34.
CopyrightCopyright © 2004 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_001011689).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-22
stage 22
Spinal Cord
Spinal Ganglia and Nerves
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.22987

Mouse

EmageMGI:1333833
EurexpressMGI:1333833
MGI GXDMGI:1333833

Frog

Xenbase950033

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-070209-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona