GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CCND1
cyclin D1

The human orthologue of this gene is associated
with the following human diseases:
Gene
Official SymbolCCND1
Official Full Namecyclin D1
CGNC ID5701
also known asG1/S-specific cyclin-D1|cyclin D1 (PRAD1: parathyroid adenomatosis 1)
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_205381
PolypeptideNP_990712
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.3039
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human595ENSG00000110092MIM:168461MIM:168461
Mouse12443ENSMUSG00000070348All phenotypic alleles (9):Targeted, knock-out(3) Targeted, other(6) MGI:88313
Xenopus448045, 379937, 3791616077305
Zebrafish100334747, 30222ENSDARG00000035750ZDB-GENE-980526-176ZFIN:ZDB-GENE-980526-176
Gene Ontology
Molecular Functionprotein kinase binding, transcription corepressor activity
Biological Processcell division, cellular response to DNA damage stimulus, G1/S transition of mitotic cell cycle, more...mitotic G1 DNA damage checkpoint, negative regulation of cell cycle arrest, negative regulation of transcription from RNA polymerase II promoter, positive regulation of cyclin-dependent protein kinase activity, positive regulation of G2/M transition of mitotic cell cycle, positive regulation of protein phosphorylation, response to UV-A, transcription, DNA-templated
Cellular Componentcyclin-dependent protein kinase holoenzyme complex, nucleus, transcriptional repressor complex
Links to other databases
Entrez Gene396341
Ensembl GeneENSGALG00000007555
KEGGgga:396341

Entry 1

GEISHA IdCCND1Data SourceGEISHA ISH Analysis
Forward cDNA Template PrimerAAGTTTTCCCCTTGGCGATG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGTCTGCTTCGTCCTCTACAGTCTTTGcDNA Template Length610
Complete cDNA Template Probeshow
AAGTTTTCCCCTTGGCGATGAATTATTTGGACAGGTTTTTGTCGTTCGAACCCCTCAAGAAAAGCCGGTTGCAATTGCT
CGGAGCTACCTGCATGTTTGTGGCTTCCAAAATGAAGGAAACGATTCCTCTGACCGCAGAAAAACTGTGCATTTACACC
GACAACTCCATCAGACCCGACGAGTTACTGCAAATGGAGCTGCTGCTGGTGAATAAGCTGAAATGGAATCTGGCTGCAA
TGACCCCCCACGATTTCATTGAACATTTCCTCACTAAAATGCCTCTGGCAGAGGACACCAAACAGATCATCCGTAAACA
TGCTCAGACTTTTGTGGCTCTGTGCGCTACAGATGTTAAATTTATTTCAAACCCACCTTCCATGATCGCAGCTGGCAGT
GTGGTAGCAGCTGTGCAAGGCCTGCATCTGGGGAACACTAACACTTTCCTCTCCTATCAATGCCTCACACATTTCCTAT
CACAAGTTATCAAATGTGATCCGGATTGTTTACGAGCCTGCCAAGAACAGATTGAATCCCTCCTTGAATCCAGTCTACG
CCAGGCACAGCAGCACAACGTATCTTCAGAAACAAAGACTGTAGAGGACGAAGCAGA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 6
stage 6
Early Mesoderm
Ectoderm
Epiblast
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
 
7-12
stage 7
stage 10
Ectoderm
Forebrain
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Primitive Streak
Somites
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
 
13-18
stage 13
stage 13
Forebrain
Foregut
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Sinus Venosus
Somites
 
19-24
stage 19
stage 19
stage 19
stage 19
stage 19
stage 19
stage 19
Cranial Ganglia
Dermatome
Ear/Otic Placode
Ectoderm
Endoderm
Eye
Forebrain
Head Mesenchyme
Hindbrain
Leg Mesenchyme
Mesencephalon
Midbrain
Myotome
Nasal Placode/Nerve
Neural Plate/Tube
Pharyngeal Arches and Clefts
Proepicardium
Rhombomeres
Sclerotome
Somatic Mesoderm
Spinal Ganglia and Nerves
Wing Mesenchyme
 
25
stage 25
stage 25
stage 25
stage 25
stage 25
Cranial Ganglia
Forebrain
Foregut
Hindbrain
Leg AER
Leg Mesenchyme
Liver
Mesencephalon
Myotome
Nasal Placode/Nerve
Oral Pharynx
Outflow Tract
Pharyngeal Arches and Clefts
Sclerotome
Somatic Mesoderm
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
Wing AER
Wing Mesenchyme
 

Entry 2

GEISHA IdCyclinD1.Lobjois.2004Data SourcePublication
Complete cDNA Template Probeshow
CTCAGCACTATCCCAAGACTGCCAGCAACAGCGAGTTCCTGGGGAAAACCCCAGGGCAAAACGCTCAGGGACTATACAG
GAGAGTTTTGTTGGAATTAGAAAGTTTTTCAGCCTCCAGAGGGCTGTAGCGGCAGTAGCAGCAGCAGCATCCAAGGGAC
TCCTGGAAGGGGAAGAGAGAGAGCGAGCGAGAGACTGACTCAGTCCTTGAGGAACTGACTCGAGACGAAGGAGGCAGAC
ATGGAACATCAGCTGCAGTGCTGCGAGGTGGAGACCATCCGACGAGCCTACCTGGACGCCAACCTGCTCAATGACAGGG
TGCTGCAGACCATGCTGAAGGCGGAGGAGACCTGCTCGCCCTCGGTGTCCTACTTCAAGTGCGTGCAGAAGGAAATCTT
GCCATATATGAGGAAAATAGTCGCCACTTGGATGCTGGAGGTCTGCGAGGAGCAGAAGTGCGAAGAGGAAGTTTTCCCC
TTGGCGATGAATTATTTGGACAGGTTTTTGTCGTTCGAACCCCTCAAGAAAAGCCGGTTGCAATTGCTCGGAGCTACCT
GCATGTTTGTGGCTTCCAAAATGAAGGAAACGATTCCTCTGACCGCAGAAAAACTGTGCATTTACACCGACAACTCCAT
CAGACCCGACGAGTTACTGCAAATGGAGCTGCTGCTGGTGAATAAGCTGAAATGGAATCTGGCTGCAATGACCCCCCAC
GATTTCATTGAACATTTCCTCACTAAAATGCCTCTGGCAGAGGACACCAAACAGATCATCCGTAAACATGCTCAGACTT
TTGTGGCTCTGTGCGCTACAGATGTTAAATTTATTTCAAACCCACCTTCCATGATCGCAGCTGGCAGTGTGGTAGCAGC
T
CitationLobjois V, Benazeraf B, Bertrand N, Medevielle F, Pituello F. Specific regulation of cyclins D1 and D2 by FGF and Shh signaling coordinates cell cycle progression, patterning, and differentiation during early steps of spinal cord development. Dev Biol. 2004 Sep 15;273(2):195-209.
CopyrightReprinted from Developmental Biology, Volume 273, Issue 2, Valérie Lobjois, Bertrand Benazeraf, Nicolas Betrand, François Medevielle and Fabienne Pituello, Specific regulation of cyclins D1 and D2 by FGF and Shh signaling coordinates cell cycle progression, patterning, and differentiation during early steps of spinal cord development, Pages 195-209, Copyright 2004, with permission from Elsevier. Copyright © 2004 Elsevier B.V. All rights reserved.
CommentsAuthors said: Gene expression patterns were analyzed using the antisense digoxigenin–RNA probe prepared from the 5′ end (870 bp) of cyclin D1 cDNA [excerpted from acc# NM_205381.1]
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 9
stage 10
stage 10
stage 10
stage 10
stage 10
stage 10
Endoderm
Neural Plate/Tube
Somites
 

Entry 3

GEISHA IdCYCLIND1.Heine.2008Data SourcePublication
Complete cDNA Template Probeshow
NNCCGAGAGNTGNNCCCCGTTATCATCATGTGGATGGAGGCAAGACGTGCTGGCAGAGCCTTACCCTTTCTTGAGAGCC
TGGGGACCCTACAGCACAGGCAACAGCAGGCTCCAGGTCCTTCCTAGGCCAAGACAATGCTAGTACCATGGAGAACCTT
ATTCTTCAGAAACAAAGCATCTCTGATTCAGCTGTTACTCAAAACAGACATTCATGTTTTAGTAGGGCTTTCTGCTTTA
ACCCATCTGAAATGTAATACCCGTTAACACAGATGTTAGCACACCTTTGCCTTTTCTTTTTCCCCCAAGAAGAGCCCGC
ACTTTAAGGTTGTAAGTCTGAGCAATTCAGTAAATGATGCAAATACAAATGAAAATTAGCCAACAAAAGAAATTCAATT
GAGTTTAATAGGAGGCTATTATCATACCTCGCATTCTCTGCTGCCCTGGCACAGGTAGGAACCAACCACAGGGGACGGA
ACAGCTCTGTCTGCTCACATAGCGCATACATACAAGGCAAACAGCAGCAGAAAACCCGGTTTATTTGACTGTAGTCATT
AGCGCTACGCATTACAGGGTCAGTGCCGCTTCGCAGAGCGCTCCGCGTGTCCCCCCGCTCCCCAAGGAGCAGCACCGCA
CGGGGCCCGACAGATGTGAGCCCACCGCGGTGGGGTCCCTCCGGCCCTCGTGTCGCTCCGCCATCCCCGTTCGGCAGCC
GAGCTTCCCGAATCGGGCCTACTGGCGTCAGCGGGGGGGGTGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGTCCCCATTCATCGCCCGGCTCCCACCGC
GCGACTCTCTCCGTTTTAAAAATTATGCACGAGGCAGCGAGGAGACGATTTGGGTTTCCCCCACCTCTCCCCTGCCCTT
GAAGAAAGCGAGCCCTCGGCTCATTTGCATCTGCATGAAACCCCTGCGCTCTATAAGCCGAGCAAAGGGGAAGGACTTG
AAGCCTATGGGATGGCTTTAGGGCTCTGCCCCTCGCTTTTGGCTCTCTCTCTCTCTCTTTCTCATTCTCTCTCGCGCTT
TGATCTCCGCTTAACAACAGTAACGTCACAGGGACTATACAGGAGAGTTTTGTTGGAAGTTAGAAAGTTTTTCAGCCTC
CAGAGGGCTGTAGCGGCAGTAGCAGCAGCAGCATCCAAGGGACTCCTGGAAGGGGAAGAGAGAGAGCGAGCGAGAGACT
GACTCAGTCCTTGAGGAACTGACTCGAGACGAAGGAGGCAGACATGGAACATCAGCTGCTGTGCTGCGAGGTGGAGACC
ATCCGACGAGCCTACCTGGACGCCAACCTGCTCAATGACAGGGTGCTGCAGACCATGCTGAAGGCGGAGGAGACCTGCT
CGCCCTCGGTGTCCTACTTCAAGTGCGTGCAGAAGGAAATCTTGCCATATATGAGGAAAATAGTCGCCACTTGGATGCT
GGAGGTGTGTATGCCGCGGGGCTCCCTCCGCGCCGGCTCTGCCCTCCGCCCCCTCCCGCANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCCGCTGCGCCGGGCACGGCGAGCCGCTCCGCGCCGACCCCCC
TTCCTCCCACGAGTCGTTCGAACGCCGCGTTTCCCCCGCTCGGCCCCCGCGACTTTCATTTTCCTTCGCACCTCCGTCG
TCCCCCCGTTTCCCGGCCGCGTTTCCCTCTCCCCCCGCGACGTCGCCCCGCGCGGCCCGGGGTGGGGGAGGGACGGGCC
GCTCTGCGCCGATGCCGAATTTGTTGTTCAACGATCTCCGTCCTTCCCGCAGGTCTGCGAGGAGCAGAAGTGCGAAGAG
GAAGTTTTCCCCTTGGCGATGAATTATTTGGACAGGTTTTTGTCGTTCGAACCCCTCAAGAAAAGCCGGTTGCAATTGC
TCGGAGCTACCTGCATGTTTGTGGCTTCCAAAATGAAGGAAACGATTCCTCTGACCGCAGAAAAACTGTGCATTTACAC
CGACAACTCCATCAGACCCGACGAGTTACTGGTAATTGCATATTTAATCGCTTCAGGCCGAAAAAAAAAAAAAAATCCA
AGAAAACCAAAAAAGAAACGGCCCCCCCGCCGAACGCGCTGATGGGGAACCCCCCGCTCGGGGCCGGGCAGGGCCGCAT
CCTCCCGCCCGCACACGCCTCCCGTCTCCGCGGGGCTGCGGACCCGCAGCGGACCCCCGCGCCCCCCGCCCCCCGCCGA
GGCTGCCCCGCTCGGAGCCGGCGCGGCGAGGCGCGACTTGGGCGACCCCTGGCGGCCGCACTGTGCGGCGCGTCCACGG
GGCTGCGGCGGGCGGCCAGGGCCGACCCCGGGCGCGGCGACCCCCGTGGGAGGGCTCCCCAGGGCCGGGCGTGGGTGGC
GGGGTCCGCGTGCACCACCGGGGCTAACCGCGCTTTCCTTCCTTCTCTTCCTCTTCTTCCCCCTTCCTCCCTTTTGTCT
TTGCAGCAAATGGAGCTGCTGCTGGTGAATAAGCTGAAATGGAATCTGGCTGCAATGACCCCCCACGATTTCATTGAAC
ATTTCCTCACTAAAATGCCTCTGGCAGAGGACACCAAACAGATCATCCGTAAACATGCTCAGACTTTTGTGGCTCTGTG
CGCTACAGGTATGAGCCCTGCACGCCCCGCAAAGCGCGTCGCTCCCCTGCGCACAGCCGGCCCTGCTCGCGGCTATGGC
TAACGCGGGCTCTCGGGGCTGTGGGGAGGGAGCTTAAGCCCTGATTGTTGCCCTTGTTGTTTGTAGAAGGTGGATTACT
CCGCGCAGGTAAGCTTTTTCAGAAGATGCTTCTGAGTTGAATGCGTTGGCCGGGGGGAGAAGCACCGCTTTGCTCTGTG
CGGCAGCATGGAGCGCACGCTGTGGGGCACGGTCCCATCGCCTCCACGCGCTGGGTTCTATCGCTGCTGGGGCGGCAAG
AAGCTCGCTGCCCACACGGGGGAATCCTGCCTGCGGATCTGTCCTAAGACAACTTCATAGGCGGAGGGAACGGCTCTGC
GTGGGGGTTTGGAAACTTCCCTCCCGAGCCGCCTCTTCCCCTCTGGCGGCGGTGGCAGGAGCCACGCGGTGCGGAGGCT
TTGCTGGCGTGGGCCCGGCGCTGCCATCTGCGCCCCGGCCACGTGCTGCGCCGCAGCCATGTGCACAGCCATGTGCAGG
GCCCCGTGCAAGCGCTCGCCAGGCCGGGTCCGCAGGGCCCCGATCGTTGGTTTCAAGGGCACCGTGCCTGTGCGCGCCG
CGGCTTTGAAGTTCCGTGTTTGCATGCGGAGTGTGTGTGTGCATTTGTGCGTGCGCCGGCTTCACCCGCTGAACCCTGG
CAGAGCGGGAAGGAAAAGCTGTCCTCCAGATCTCGCGGTTCCCACAGACCGGAGCGGAGGAGCAGGACAAAAGAAGTCC
TGGAGGGAAGATAGATCCGCTGCTCAAACGCGGTGCGTTCGGTGCGTTGGCTCTCGGTATGATGAGACAAATGCCCAAA
TGGCAAAGGAATAAGGAAGAAAAAGCAACCAAAGCAAATGTTCTTTTGCAGTAGCACGTAAAGAGGAATGCCAGACGCT
GTTAGCACTGATAAAACGTAGTGCAAAGGAGATACTGTGCTGCATTAAACGCTAATATTTGGTAGCGGCCGTGTTGGAA
GATATCAAACCTGCAGCGGCACCTGGGATACCTTGGTGGGATGTGTGGTCAGCCCAGATAGGGAAGCTCGTCTTCCAGA
TGCAGATTTGGTAAAAGGATTCAAGGGACATCTGCAGGTACTCAGAAGAAACTGTGGGTTACGCAGAGCCTACTGATAG
AGGCCCAGAGACAGAACCAAGCCCTGATGGGACGTCTATAAGCACTGGCATCGCCCGGCACGGTGGGGCGGCTCCGAAG
TCAGACTGCAGCAGCACTGCTCCGGGATTGGGGCGTGCAGCCCCCCAACAGCCTTCACACCGCCTGCAGCAGCACCACG
GGAAAATCAGACGTGCTCTCTCCATGGCAGATCCCACCAGATAAAGCTGCTGGACCCTAAACGTGTAACTCGTTGGCTT
GACGCTACCTCAGCTGTTAGCTAAAAAGAACAGCTACCCAGCCTCCCCTTGGATATGGGGATGGTTAACCTAGGTTGTT
GTGTTGGCAGTGACAGGGATGAAAACAAGAGTAGTTCAAAGGTTGGGGACTCGCTAAGGGTCCGGTACTTTGATCTACT
GTCGGTGTTGTTATGTTTCTTCTAGGAAGCACATCTAGAGCCTTTATTTAACACTGGTACAAACCACAGCTGGAGAATA
CATCAGTAAACGAGAGCCATGTTCTGGGAGTTCTACTTAGCTTTTGAAAAACAGTGCTGAGCTCACCGGAACTGGGGCC
CTCTTTGGCTCCCTTCTCAAGCTGGGAATATTTCCTGGGGAAAGTGCGTGCAGAAGGGCTGCCACTGGGCTCTGTATTT
TTATTGTTATTTTTGGATGTTGGGATTTTCTCTACCTCTTGCTTTCCCCGTGACTTCTTTGTTGGCTAGTGAAGATAAC
GTGTGGCTTAAGTAGCATCTGGACTTTGCTTTGCTGCTGCTGGGTTGTATTTCCCTTTGCCAAAACGAGCCTAGATGGA
CTGCAAATGCCTTGTGTTGCCTGGATGCTGTGCTGTGGGGCCCAATCCAAAGTCCACTGGAAACACTGTGAAACTTAAT
GAAGTGGCCTCGGGGGCGAGCTCAGTATGTCCTCCGCTTGAAGTGCACAGCCCGTGTCCCCTCCTGAAGGAGGGGCTCC
TGAGAGGAGGCAGCAAAATAAGGCTGGCTTAGAAAGTAAGATCTCTGCCAGTTGGCTTAGCAAGGTGAATGCTGTGGAA
GTGTTTGTGGATGAGTGTGCATGCGTGCTTGCTCCAGAATGAGAAGGTTACGTCGCAAGGTGAAGTGGAGGGGAATTCC
TTCTGAGCTCCCTCTTCAGTTGCCTGGCTAGTAGAAGTGGATTTGTTTGATTTGGTTCAGTTTCGAGAAATGCATTTTC
ACCAAAGGATGTCTTTGTGCTGTGGTAGGTTTGGGAGAAAAAGAGAAAAAAAAAATTACCAGGGGTTGTTTGAAGTTAA
CACATAATTGAGCTTAATGAATGGGGCTTTGGCACAGCTGAACAAGACAGGGATGGCTCAAAAGGAAGCAGGCCTCTTT
TGGCCCAAGTTAAGACCAGTGTTGAGGGAGAACTGCGGCTCTATACAAGCATAACAATGAATAGCAACAAATATTGGAG
CTTCAGCATTTCATTATGCTCCTCTGGTTATCAAAACATACCGGGCTCCTTTTATATTATTATTATCATCGCCATTATT
ATTGTTGTTGCTTTCCTCCTCTCGAACGGAGGAAGAAAGATCTCGCTTTGAAACAGCCGGGTTACAATTCTCCTATTCT
CTGGCCTTTATAAAATTGGGAGTCTCAAGGTATGTGACCAGTTGGAACCTGTTGCATCTTGCAGCAAGTGATTTATGTT
CGCAGTTTTGATTTGCCTCAATGAAAAGATTTTCATTCATAGCCCCCAGCTCTCCAGACGGATGGAACTGCTGCTCCAT
TTAAAAAGGAAAAGGGGTGACTCGCCTTGTTAGGAATTTTTTTTAAAGCGCTGCAGCGCCTATATGCCTGCTTTGTCCT
CCCTTCAGGGTGGCTGGCATTCTTCTCTCTCCTCCCCCTCCCCTCTCTCTCTCTCTCTCTTTTTAACAACGCTGAAGTT
GTTTATTCTTTTTGGATGAAGTCTCAGATAGGCTACTGGGGATGTGTGCTTCAATTGATGGGGCCCCCTACCCCATTGT
GGCTGTGTCAGGTCTAATTCATCTCACCGAAGCCCCCTTGTTCCTGAGCGCTCAATAGCGCAAGATGAGGCGATGGAGG
CTGACAATGATGCCACACTCTTCACTTGGGGGCATCCAATTACAGGCGAGAGGGGCCCCCTGATTAATATGCTGAAATT
AGTGGCCTCTGCCACAAATAATTCCTTGTTGAGTTGCAACAAAAAGGCAGTCCATGCTGCTTGTCTGGAGTGGTTATAG
GGACAGACGCAAACTGGTCATTTAAACTTCATTATCACTTTTCCACCTTGGAAAGAATGAGGGTGTGACTATGAATTCA
TGTTCTTGTTTACTGCTCCATTTAAAAGAAGAACGCAAATATTAATCCCAAACATGATCTTGTCAGGACGGACTTCATT
AAAGTGACACATTTTGGCCACGTCCTGTGCGTGGAAAGCAGTCAGTGCTGGCGTGAAGTCACTGCCACTGTATCCCGCT
GGAAACCAAATCATGGTGGGGATTCACGTTCGCCTGCTGAAGGCCCTTGCTTCTGGAGCCCACCTGCCACTGCCTTTCA
GTATTTCAGCTGGGAGACCATCTCTGGAATGCGCACGTTGTCAATAACCAACCGTAACTATCTTGATCTGGGGGAATGA
CAGGAGCTTGATCCAAGGTGTGTGTACTTAACATCTGCCCCGAAATGGGCGGGTCAGGAAAAGGGGGCAAATTACGTTT
GCTTTGAACGCGGTGGCGCGCAGGAGATGGCTTTAGACCAAGGTTGGCTTTTTGCTGGCAGCGCATCACAAAAGCTGGG
CCACAATTAATCGTATCGGTTGTAATGTGAAGGTTCATAGAGCGCGGGGCGAAATGCCCTTTTGAAGGTGGGTATTGGT
CTGGGCTACAACGAAGCGTCAGAGATACGTGAACAGATTCACAGAGAGGGGACTTCCACAGAGCGCTGGAGGCTTTAGT
TTCACTGGTAAAACATTGTCACAAAAGTTATTTTATCATAATAAAGGAGATGCATGATTTAATACTTACACCGTTCCAC
TGAGCTCTCTAAGCTGTCCATCCCTTTGATTTCATTCAGGGCTTTGACAGATGGTTTATATTTTTTCAGCCCGGAGGAA
GTTGTATTCTGATAAAAGCTGAAGGACTGTATCTCAGGTTCTTGGGTATAATGTGGCATTTCCCCTCCTTCCTCACAAA
ATCAGATGTTTGCTTTGCGCCCCTCTTTCCTTTTCTTTTCGATTCCCCCTCCAAGGTGTACGCTGCCACACATCAAACG
CATTCCTGTTCAGCGGAAAGAGTCTTAGCATTAAAACGTGGATTATTCTTATTAAAAAACACGCACCAAAACCATGCTA
AATGGCAGAGATAGCCCCTTAAGGAATCATGGGAGTGGCTTTGTGGAGAGACCTACAGCACTGCAGTCTGGAAGGGGGC
CCAGCCTCTTGTCAGCATGGTGTCACATCAGAATGTAACTGATTGTCCGCCAATTCTTGGGACCCCCGTCACTTAGTTA
TGCCACATTTACATTAAATCCCTGTTGCCGGGATGGATGGCAGCCACGGACAAGAGACTAGGTCGAGACAAAGCATTTT
TAAGATGAAACCTTAATTTAAATATGGATTATCTGCCTCCTGACAGGGCTAAGCGGTCTCTCTCTTCCTTTCTTTTTAC
TGATGTCGCCGTTCATTAAAGCCATATTCCTCTGAATGTCAGTGCTTTGAAAGGGCCCGGGGACTCCGGTCTGAGCGCA
CCTAGGGCCTGCTGGTGCGCAATACTGGGGAATGGGAGCGGGTTTCCCCTGCGGCACTGCGCCACGCGAGTGGAGTGCT
GTGATGCTGAGGTCCCCAGGTGGCGGTGGCCTTCCAGGCGTTGTGGGCAGCGGGCTGCCCGGACCGGTGTTGGCAGGTT
GGGGCCCGTGACAGCTCAGAGCGGGAGGCACTGGTGTTTGGGTGCAGCAGCTGGCAGCTGAAGCCATGTTGGGAGAAGA
GAGCGTAATGTGTATGGGCAGGCTTCTACAGCAATCATTTCAGTCTTTTTTTTTTCTTTTTTTTTTTTTTTTCCCTCTT
CTTTCTTCATACAGATGTTAAATTTATTTCAAACCCACCTTCCATGATCGCAGCTGGCAGTGTGGTAGCAGCTGTGCAA
GGCCTGCATCTGGGGAACACTAACACTTTCCTCTCCTATCAATGCCTCACACATTTCCTATCACAAGTTATCAAATGTG
ATCCGGTAAGTGCCTCTTCTCAGTTGATCCTTCTGCCTTAGAGTTTAAGAATGAATGCCTGCTTGCTGCGCAGTAGCTA
ATCTGGCAGTAAATCTCGATAAAGGTCAAACCTCAGAGTGTGTTGTGTGAAGATGCTGGCTGGTGTTCGTCCCCGTTCT
GTGCTGTCGTTACAGTCATTAATAATGGGCAGTTGCAGTGCTGCACTTTACTGATAGGAACGCCACGTCCAGCTCTGGT
GTTCCTGAGAGGCGTATCTGACAGCGCAGAGGAAACCCTGAGCCGAGCTGGGGCGATGGTAAAAGCCGTATTTGCTTGT
AGGTAATTAAACAGCAGTCTGTGCAAAAGAAAACTATTCAAATAAAGACGAGGAAATAGTTACTGGGATTGCAATAAAT
GGACCTCGTGGTATCTCTGACCTTATCTTTGACCATTCTTGAGGCCTTTTATTGTGCCAAGTGGTGTGAAAAAGCCCTT
CTTAAAAGAGTTCTAATGATCTAATTTGGTTTATTACGTGCTAGACCTGCACAGTAGCTGGTATTGAATTCCTTTTTGG
AACAAATGCTTGTCCCACGACTTTCTGACAAGGTAGATGGTCCTCACAGGACTCTCATTTTGCCCTGCAGCTTCCAGGA
GATGCACATCAGCAACTAGCGAGCAATAAACCTTTCATGAGTGAATGGGCCAGGAAGGGAGCCTACAAGGAAGACCTAA
AGTCAATGATCCATGTCATAATGGTGTGTGAAGTTGGGGCAGAGTTGAGCTTTGTTTTGCAACAATGTGGAAGACCAAT
AAATAGATGCTTTTAAAAGGTTCCTGTGAGGTCTCCCAGTGCTGGACAATGAGACAAATAAAGACAACTCTGTGGTTAG
GGCAGAATCTTTGAGATGCTGTTAAATAATTTTACACGTTAATAATCTAAATCCATACAGAGTTTCATTAGTCCAGGTC
CATCAGAACTAGTTCTGTGTAACTGGGCGTTGTTGGCAGGATTGAGTGATTTCTGGAAAGATGAATGCATCAGAACGAA
TTATTCACAGCAGAATATTTTACGTTAGATAAACGATGTGAAACAACTGCTGACAAATATTATATCACAGCTTATTTTT
TGGATCACTTTCACAATGCCTCAGTGTTTACTGTGTTGGTTTTGCCATTTATGTTACCGCAGCTGAAGTAGCATGGATC
CAGCACTGGAATATTAGATGTTACAGGAACTTTAAATGCTGAAGTAAAATGCTGTAGATATCCTGCAGCTCAGTTTGGT
ATGGACATGTCATGCTTTCAGTGAGTTTGGGAACAGTGTAGGGACGTCGGTGTACGATCGGCCTCTCCTTGGCGCAAGA
TGGCTGAAGGAGGTACTGGGGAAAAATTCTAGGCTTGCTGTTGGTACTGACAGCATCTGACTCAAACAGAGATAGCATT
TAATCATTCCTGACAGAGCACTGAAGGAGATGCTCTCACACCTTGGAGAACAAGAGCACGTCCTTGTATGACTTATTTG
ATGACAGCTCTTTGTGTATATATGTTGTGTTTGTAATGGAGTAGGAGTACAGCATCTTTCACTGCTATTAGTTTGGAAA
GGGCAAATTGCTTAGTTTTTGTACATAGCGTGATTCCCTTGCACATTTTCCCATAAGGCAGGCCCATGTAAGCCTACTG
CTAGTATCTATTTAGCTGGCATCCACGTGAAGTTTGTTACTCCACAGTGATGGTTCACCTTTGTCAGCCTGCGTGACTG
AAGCCCTTTATACTGCTGTGGCTGAAATATTAAGAGTGTGCATTATAACGGCATGGCTAACGTTCTCCCAGATTATCTG
TTAGCTAGAGCAGCCGCTCTGTTGGATTTCAGGTTATATGATTACACTTTTTTACCTTTAGTCTCAAAGAAAGCTGAAT
CTAAAGTAAAATGGCTATCACCTGATTGGGATTCCTTTATGGTTCATGTTTATGTTGGTAGGAGTCCAATTTCCCATTT
TGCCTTTGATCAGGGGTAATTAGAAGTCAGATAATCACAATTAGAAGTCTTGGGCTGTCTTCCATCATTCTATTCTTGA
CCCCATCATCCAAACAGATGGAATTTTACCTGACATTCATTTCCAGGCCAGAAATTTGCTAAACTAGATTAGATTGGGT
TTCCATGCTGTCTGTTAGCGCATTGGAATTCGTCTCCTGCCTGCCCCTACTCAGAGGCACCTTCAGACATGTGCTTGTT
ATCCAGAGCGGGTCAGGCAGTAACAAAGGACTTCCGAGCAGCTTCTTTTTTGTTGTTGTTGTTTATTTCCTTTAGTATC
TGACCCCGGAGTGTGATCATGTCTGCTGTGTGTGTTAAAGGTATTTGACCACATCAGTTAAGCTAGCAAGTCTTTTTTT
TTTTTTTTTTTCCACTGAGGGTCTTAATTAATCCAGGAAGGGTTTATGACCTTGAACAAACTGTGGGCATTGAAAATTT
GGGTAGTGAAGCAGAAAAGTTGTTGGGAGAAGTTATCAGAATAATGCACAAGTTTAGTGTTTGCTTTCCAGCATTGAGA
AGTACTAAGAATGAAAACAAGCTTTTATTAGGTTGTTCACGGTGAATTTTGTATTTTGCAGTTATTTTTGCTAGCCCTC
ACATATTCCTGCCAGCAAACCGCTCATCTGGTAACTAACTGAGTAATACGTGGTTTGAAACAAAATGCCCAACACTTAA
AATACTGTCCATCACCTGCAGCAGAAGACTGCCATTCATAAAAATTGTAAGGATAATGCTTTACAACATATTATGCAGT
TCTTACATGCTGTGCTGTGAGACTTTCACAGGAATTAAAAATACCTGTGGTCAAAAATAACCTTTAAATGATGCAGTTC
CATGTATTAATTGGCAGCTGAACTCCAGGGAGAAGAATAGGTATTTATTCAAATCCTATTGAATGGTTTGAATTTTCAG
AACTTGGACATGCTATATGCAAATAGCAACATTAAAAACAAAAACAGGGTTTGCTTTGCTCTGAAAATAAACTGGCTTC
AGTTTGGAATCCTGGGCATAGTACCTTGTTATAACAGAATTATCTGAAAAAGTGCCTGGATTTGTAAAAGTGAAAATCC
CCAAACTGCTATTCATGTTCCGTTTAATACATCTAATTCCAAGTGTGGCTGAGGTATGTGCTGCAGGACGGGCGAGCAG
CAGCCGCACAGACAGGATTGATCTGTCATATCTCAGGAAGGGGTGAGGGGCTTCACAGGGAACTTAGTGGGAAGGCCAG
AGGAATGCAGGAGCCAAAGGCATCATGACTTCAGGATATGAGGCGTTTCTTTTTGTCATTTAAAACGCTGTGTGTCTCT
GTCAAGAGGAAATATTACACTAGGGTTTAAACCAAGAAAGGTCATAGGTTATGTGTTTTCAGTGAGCTGTAACTGATGG
TCTGATCTGCTTAGAGGTAGGATTAACCTCCCTCTCTCTCAGAAAGGCCTCGCAGAGAATTGTTTGCTTGGGTTTCTAA
TCTTATTTTACCCCAAATGCCATGTGCCCTTATTGGTGGCAGAGGAGATTCTTGTGGTAGTGGAATCAGTGAAAAGCTG
GTAGATCACACAAGAAGCCTCTGAATGAAGGCAGAATTGAAACTGGGAAATAAAGAAAACAGCAGGCAGGTCACCCTCT
CAGGAAAACAACATTCATTCTCAGTCATGCACATCCTAACACTTTTGACGGCAATTTATCATGGAAGACTGGGTTCACC
GCAAGGGCTAACACATGTCATAGGTTAAATCAGAAAAGGCAGTACTGAAAGGAAACTTCAAAGTCCTTCAGACACAGAG
TTAAATATGTTGGGAAAAAGCTTACGATATTTGTTGTATAGATAAGAGTAAACAGCACGCTGGAGGAACTTTGGCAAAA
CAGTGGGATTGTTGTGCCTGTTGAGGCACCAGTTCTGTGCCCTCGCAGTGGATGTGCGTGGCTCTGAAGAATGCAGCCG
TAGCTCGCAGGAGGTCGGACAGGTTGAGCTGACAGGCCTTCTCCAAATGGAATTGCTGCACATCAATAGGTAGACTTTG
GATGTGCCTGCTCGTGGTTTGCTCAATGGCTGGGGAAGTTCCCCTTTCCCACAGTAGACCTGGTCCTGCTGGGCGCCTG
CTGCTCTCCATTCAAACCGCAGCCGGTGCACAGTACAGCCATGGCACCTTCCGGAGCGGGCATACAGCTCCAGACGTGG
GCTGTGAAGCTGGGGAAAGAGCTCCCACTCTGAGCTGGATGCAGTATCCAACTGAAAGCGTGGCAGCACCTTAATGATG
CTTCTAAAAGATCTCTGCACTTTGGGGTCTTGCAGGCGGTTACGTTTCTCTGTTCAGATGCTTTCTGAGTTAGAAGTCA
GTTAGCTAGCCTGAGCTGCCCACTACTGCAGATAGTAGCAGCTGGCAGGCAGCTTCAGCTGTGTGTTATCTAAGCATGC
CACTTTTGTTGAAGAGCTTTCTCTGCCAAGGTCCTGCCAGGTTGGCTACTGCCCGTGTTACTGCAGGAGCGTGCACCAC
ATCCATGGAGCTGTGTGTGCTGACACAAGGAGCAAAGTGACAGTTGTCAGAGGAGCACGTGTGGAGCTGCTCATTGAGG
CTGTTAAATGGAAGATGGCAGGAGTTACTGCTGAAGGCTGGAGCCAGTTAGCATCCTGCAGCAGTTGGGGTACCTCATC
CAATACTTGCACTGTTCAGCATTGCTCTTCCTGCACTCCCAGATAACTTGACTGTATTTCTTGTGGCGTTTCAAGAAAT
GGTATTTTGCCTGTGATGTTGGTATTTTTCTAAAGAACCCTGGGTCTTTTTTCTCCTCCCGCTCAATCTTCCCTAGGAT
TGTTTACGAGCCTGCCAAGAACAGATTGAATCCCTCCTTGAATCCAGTCTACGCCAGGCACAGCAGCACAACGTATCTT
CAGAAACAAAGACTGTAGAGGACGAAGCAGACCTTTCCTGCACACCCACTGATGTGCGAGATGTGAACATTTAAGAGGA
CTTCTTCTAATGGGTTTGCTTGGCAAGAGAAGCAGACAAAGAAAGGGCATCTGAGAAGGAATCAGCATCGGGATCTCCC
CCCCAGAAACCCTTTTCTCCAGGACGTTTTTATACCAGAAGGGAAAACCAGTCTTGTTATATTTTTTCTTGCTCTGTCT
CCCTTCCATCTGTGACTTCAAACAAACAAATAAACAAAAAATACCCCAAAAACTGTCTTAAAAAAGGAAAAAAAATAGT
ATTTGCATTGCCCCCAGGGGTCTGTGCTACAAAAATAGAGGATTTTATACAATAATAATCAACTAGTTTTTATATTAAA
GTGTTCTTGTCTGTATGTTGTAAAAATAGGCATTAACACACAAAATGTCTCCAGGGGAGGTATTAGATTTGATTTCTTA
CATATAAAACCAACCAACCAACCAACCAACCATTTTTAAAGTAGAAGAGGGTTTTTTTAGATAGTAAATGAAATACTCT
TTTTTTTTTTCCTTAAAAAGCATAACTTTAACGCAGTTCTAGGCTTTTCTGTATCTTGCTTGCTTATGCATTTAGTCAC
TTTATAATTCATCTGTAAATGTTTATTTTATTTCCTTAGGTTTTTTTTTTATCCTCTTCACCTTATAAATGGTTAACGT
AACCCATAAGTTAGTGTATGTTAGTATACAGCATTATTATATGTTAATCTTTTTTTTTTTTTTGTGCCTGTGGATTGCC
TGTGCATTTGTAGGGTTCCAGCTTAGCGTTGTTGGGAAAGGCCAATGTACTACTCATACGATACTCTATTATAAAGAGA
AACCGAAATAGTGACATAATATATTATATTTTTGTAATCTTCATATTTTTGTAGTTACCTGTGTAAAAATGCTGGTCTG
ACCCCACAGATATTCAGCCTAATTATGGTCAGGTTCAATCCACAGTTTAGTCTTTTTTGTTTGTTTGTAATATTCTAAA
ACCATTCCATTCAAAGCACTTTCAGTCCATTAGATATAGGAAATACATTCTTTTATTGTGTGGGAATTGTTTTTGTTTT
TTTGTTTTTTTTTTTAATGGAATGGTTTGGAAATATATTAAGTGCTTGTTCGCAAACTCAGAATTGCAAAGCAAGTGCA
TTTAACTATGGTGTTAGAGGAGAGGTGAATTTTTTTTCCGAAGGTTGTGTTCCAGTGAGAGAAATTGCATTCACAAATT
GCCAGGATATCTTCCTATCCTTTTCTATAGAAAAGTTGAAGTTTAGAAATCCTTTGGTGCCAACACACGGTTATAAATT
AGGGGCCTTAAAGGTTCACGTATAGGACGCATAGTTTAAGGACTGTCTCTAGATGTTTTACAACTGAAGGTTTTTAAAC
ACTAAAATATATAATTTATAGTTAAGGCTAAAAAGAATATTTATTGCAGAGGATGTTCGTAAGGCCAGTATGATTTGTA
AAATAATGCAATCGCCCCTCTTTGAAAAAAAGAATCGTTCTACCCTTCATGTCGCAGTTTTAACACAGCTTATTAAAGA
AAAAGGACACGCTTCAGAGAACAAACCCAAAACCAAGCAGTCTATTTGGCCCCTCAGACATTTTCAATAGCAGGCTAAC
CATGAAAAAACGCCATAGTTAATAGATATGAAAATTGGAGTACTTGAAAGAAGTTCTTATTCCAGTATATGCCCCATGT
TTTTTTTTTATTTAGCTACAAATAGAAAATTTGCACATCTTGGCTATGTATCTTTTTATTATTATTTTAGGAAGTAGCT
GAAGGGACGTGGACATAGCTGTTGAAGTTGATGCTCGAGGAGAATGTGATGGTGAAATGTATGTGAGAAAACTGCCGCT
AAGGTGTTGATTGTAAAAACAATACAAAACAGAAAAAGGAACAGAGGAAAAAAAAAAAGAAAAAAGAAGAAAAAAAAGA
AAAAAAAAAAAAAGAAAAAGAGAAAAGAGAAAAGAAAAGGAGTGGATGCTCCATTTTTATTGAGCTGCTATGGATAAAT
TCCCAGCATGGTTTGAAAAAAAATTAACATTGCTTTTCTGTATCTTTGTCATTGTGTTTTGCTGCTATTTTGTGGATCA
GTTTTTTTTTTTTTTTTTTTTGTTATACAATGTCATATACTGCCATGTTATAGGTTTTAATTTTCTCATAGAAAATTAT
ATTATTGACATCATTTTTTTTTTTGTAGATTT
CitationHeine P, Dohle E, Bumsted-O'Brien K, Engelkamp D, Schulte D. Evidence for an evolutionary conserved role of homothorax/Meis1/2 during vertebrate retina development. Development. 2008 Mar;135(5):805-11. doi: 10.1242/dev.012088. Epub 2008 Jan 23.
CopyrightCopyright held by the authors. Published by the Company of Biologists Ltd.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-15
stage 15
stage 15
Eye
Lens
Retina
 

Entry 4

GEISHA IdcyclinD1.Olivera-Martinez.2014Data SourcePublication
Complete cDNA Template Probeshow
CTCAGCACTATCCCAAGACTGCCAGCAACAGCGAGTTCCTGGGGAAAACCCCAGGGCAAAACGCTCAGGGACTATACAG
GAGAGTTTTGTTGGAATTAGAAAGTTTTTCAGCCTCCAGAGGGCTGTAGCGGCAGTAGCAGCAGCAGCATCCAAGGGAC
TCCTGGAAGGGGAAGAGAGAGAGCGAGCGAGAGACTGACTCAGTCCTTGAGGAACTGACTCGAGACGAAGGAGGCAGAC
ATGGAACATCAGCTGCAGTGCTGCGAGGTGGAGACCATCCGACGAGCCTACCTGGACGCCAACCTGCTCAATGACAGGG
TGCTGCAGACCATGCTGAAGGCGGAGGAGACCTGCTCGCCCTCGGTGTCCTACTTCAAGTGCGTGCAGAAGGAAATCTT
GCCATATATGAGGAAAATAGTCGCCACTTGGATGCTGGAGGTCTGCGAGGAGCAGAAGTGCGAAGAGGAAGTTTTCCCC
TTGGCGATGAATTATTTGGACAGGTTTTTGTCGTTCGAACCCCTCAAGAAAAGCCGGTTGCAATTGCTCGGAGCTACCT
GCATGTTTGTGGCTTCCAAAATGAAGGAAACGATTCCTCTGACCGCAGAAAAACTGTGCATTTACACCGACAACTCCAT
CAGACCCGACGAGTTACTGCAAATGGAGCTGCTGCTGGTGAATAAGCTGAAATGGAATCTGGCTGCAATGACCCCCCAC
GATTTCATTGAACATTTCCTCACTAAAATGCCTCTGGCAGAGGACACCAAACAGATCATCCGTAAACATGCTCAGACTT
TTGTGGCTCTGTGCGCTACAGATGTTAAATTTATTTCAAACCCACCTTCCATGATCGCAGCTGGCAGTGTGGTAGCAGC
TGTGCAAGGCCTGCATCTGGGGAACACTAACACTTTCCTCTCCTATCAATGCCTCACACATTTCCTATCACAAGTTATC
AAATGTGATCCGGATTGTTTACGAGCCTGCCAAGAACAGATTGAATCCCTCCTTGAATCCAGTCTACGCCAGGCACAGC
AGCACAACGTATCTTCAGAAACAAAGACTGTAGAGGACGAAGCAGACCTTTCCTGCACACCCACTGATGTGCGAGATGT
GAACATTTAAGAGGACTTCTTCTAATGGGTTTGCTTGGCAAGAGAAGCAGACAAAGAAAGGGCATCTGAGAAGGAATCA
GCATCGGGATCTCCCCCCCAGAAACCCTTTTCTCCAGGACGTTTTTATACCAGAAGGGAAAACCAGTCTTGTTATATTT
TTTCTTGCTCTGTCTCCCTTCCATCTGTGACTTCAAACAAACATCA
CitationIsabel Olivera-Martinez, Nick Schurch, Roman A Li, Junfang Song, Pamela A Halley, Raman M Das, Dave W Burt, Geoffrey J Barton, Kate G Storey. Major transcriptome re-organisation and abrupt changes in signalling, cell cycle and chromatin regulation at neural differentiation in vivo. Development 2014 Aug;141(16):3266-76. Epub 2014 Jul 25. DOI: 10.1242/dev.112623.
CopyrightCopyright © 2014. Published by The Company of Biologists Ltd.
CommentsAuthors indicated the probe was made from gene construct provided by A. Munsterberg. As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence above was obtained from NCBI (accession number NM_205381.1).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
Neural Plate/Tube
Somites
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.3039

Mouse

EmageMGI:88313
EurexpressMGI:88313
MGI GXDMGI:88313

Frog

Xenbase6077305

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-176
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona