GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CDX2
caudal type homeobox 2

Gene
Official SymbolCDX2
Official Full Namecaudal type homeobox 2
CGNC ID12839
also known ashomeobox protein CDX-2|caudal type homeo box transcription factor 2|caudal type homeobox transcription factor 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204311
PolypeptideNP_989642
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.967
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1045MIM:600297
Mouse12591ENSMUSG00000029646All phenotypic alleles (6):Targeted, knock-out(2) Targeted, other(4) MGI:88361
Xenopus394817, 735025483305
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene374205
Ensembl Gene
KEGGgga:374205

Entry 1

GEISHA IdCDX2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerTGTCGGAGAGGCAGGTGAAAATC
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGCCCAACAGCATCGCTCAGACCcDNA Template Length506
Forward cDNA Template Probeshow
CGCCGATCCTCGAGATTCACTGGGGAGTGCCACGCTCCCCTTACACCTAACAAAGGCCAGGGTAAAAAATATCCTTTTA
AAAATGAAAGGGAAAATTCCCACGAAAGAAAACCCTAATAACCTTAATAACCCCCAAACCGCGGTTCCCCGGACGAAAC
CCGCTCACTGTACATCTGTACACACGGGCGCTGCAGTGTATTGGGGGCGCTCCCCCTGTGGCCCCCGGGGCGGATCCGG
CCCCCGAGTTTCGGCTGCCCCGTTTACAAAATACTTCTAGAAAAATTACTCTCCCTCCGCCCCAAGGATTAGGAAACCA
ATTTTTCCCCGGCCTTAAAGAAAAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Early Mesoderm
Extraembryonic Mesoderm
Primitive Streak
 
7-12
stage 8
stage 9
stage 10
stage 11
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
 
13-18
stage 18
Foregut
 
19-24
stage 20
stage 20
stage 20
stage 20
stage 22
stage 22
stage 22
stage 24
stage 24
Duodenum
Foregut
Midgut
Sclerotome
Stomach
 

Entry 2

GEISHA IdCDX2.Pernaute.2010Data SourcePublication
Complete cDNA Template Probeshow
GGGGCCCCGCGGCCACAGCGGGAGCGGCCCCAATGCACTGCAGCGCCGTGTGTACAGATGTACAGTGAGCGCGTCTCGT
CCGGGGAACCGCGGCTTCGGTGTTATTAATGTTATTATGGTTTTCTTTCGTCGGTATTTTTCCTTTTATTTTTTATTTT
TTTTTTTTTTTACCCGGGCCTTGGTTAGGTGTAAGGGGAGCGTGGCACTCCCCAGTGAATCTCAGGGATCGGCGCGAAG
GTCTGAGCGATGCTGTGGGGCTGACGATGAATTTTATGGGGAAAGAAAGAAAGAAAAAATTAAAGCACATGGTTTTTAT
ATTATATTTTTAAATTTTATATTTCCCTTTTGGGGTTACGGGGTCGCCACGTGAAAATTGTGCAAAGGCGTCCGTAAGG
GGCTCAAAGCAGACCAGGGTGAGCGGGGTTACAGGGTGTGCGGCGGGAAAGGGCCCCGGGTTCAGCCACCTCCATAAAA
CTCGTGTACGCCCGGGTGCTGAGGGCCACGCGGACGAGAGAAGGGGCAGAAGGGAAGCCCTCGTGAAATTGGGACCCAG
ACCACGCGGGGATGAGGATCCCGTGGTGTGCAGAGAGCTGCCAGAGAGCCCAAATGTGTGGTCCACAGGCAGTGACCCC
GGTGGTCACTCCCGCGGGACAACCAGGCCTGGATATGAGGCAGCTGGGGTGCCCCAGGGGGCTCAGGTTTACAGAAGCG
CCTACATGCGGAGTCCCCCAGCACCGGCTTAACACACACCCGGGAGCCGAAAAACCATCAGGGGGAGTCCATGGGCCAA
TTCCC
CitationPernaute B, Cañon S, Crespo M, Fernandez-Tresguerres B, Rayon T, Manzanares M. Comparison of extraembryonic expression of Eomes and Cdx2 in pregastrulation chick and mouse embryo unveils regulatory changes along evolution. Dev Dyn. 2010 Feb;239(2):620-9. doi: 10.1002/dvdy.22176.
CopyrightCopyright © 2009 Wiley-Liss, Inc.
CommentsThe cDNA template used to generate the probe was obtained from EST Clone ID: ChEST626o23 using the information provided in the publication.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-2
stage 1
stage 1
stage 1
stage 1
stage 2
Area Opaca
Unlabeled
embryo stage = EGX-X
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.967

Mouse

EmageMGI:88361
EurexpressMGI:88361
MGI GXDMGI:88361

Frog

Xenbase483305

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona