Quick Search
X XI XII XIII XIV 1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16 17 18 19 20 21 22 23 24
25 26 27 28 29 30 31 32 33 34 35 36
37 38 38 40 41 42 43 44
Gene Family QuickSearch
Human Disease Gene Search
CES1L1 Gene Summary Expression Transcript Levels Other Species Expression JBrowse Gene Official Symbol CES1L1 Official Full Name carboxylesterase 1 like 1 CGNC ID 50076 also known as CES1, LOW QUALITY PROTEIN: fatty acyl-CoA hydrolase precursor, medium chain|carboxylesterase 1 (monocyte/macrophage serine esterase 1)|fatty acyl-CoA hydrolase precursor, medium chain|thiolesterase B gene type protein-coding
Genomic Map Sequence Information Gene Expression Orthology Gene Ontology Molecular Function Biological Process Cellular Component
Links to other databases
GEISHA Id CES1.Roy.2013 Data Source Publication Complete cDNA Template Probe show AGCGTTTGTGTTGCGCAACAGCTGTACTTACAGAGTACTAAAGGCAGTGCACGGAGTGGGTCAGTGTGTGAGTAGGCTG
Citation Roy P, Kumar B, Shende A, Singh A, Meena A, Ghosal R, Ranganathan M, Bandyopadhyay A. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes. PLoS One. 2013 May 22;8(5):e63670 Copyright This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Comments As insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI XM_004944241.1
Stage Image (click image to view full size) Location (click to highlight) Comments (click to highlight) 25-26
stage 26
stage 26
Leg
Data from NCBI Unigene EST ProfileGga.8312
Mouse Frog Fruit Fly Zebra Finch Zebrafish
