GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

CRABP1
cellular retinoic acid binding protein 1

Gene
Official SymbolCRABP1
Official Full Namecellular retinoic acid binding protein 1
CGNC ID49086
also known asCRABP-I, cCRABP-I, cellular retinoic acid-binding protein 1|cellular retinoic acid binding protein I (CRABP-I) homologue|cellular retinoic acid-binding protein I
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001030539
PolypeptideNP_001025710
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4546
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1381ENSG00000166426MIM:180230
Mouse12903ENSMUSG00000032291All phenotypic alleles (3):Targeted, knock-out(2) Targeted, other(1) MGI:88490
Xenopus100037896, 100174812962770
Zebrafish171479, 415102ENSDARG00000045926, ENSDARG00000035904ZDB-GENE-020320-3, ZDB-GENE-040624-3ZFIN:ZDB-GENE-020320-3, ZFIN:ZDB-GENE-040624-3
Gene Ontology
Molecular Functionretinal binding, retinol binding, transporter activity
Biological Process
Cellular Componentcytoplasm
Links to other databases
Entrez Gene374211
Ensembl GeneENSGALG00000003193
KEGGgga:374211

Entry 1

GEISHA IdCRABP1.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerACATCAAAACTTCCACCACTGTCC
Reverse cDNA Template PrimerATTAACCCTCACTAAAGGACACACACGGTCACATACAACACCcDNA Template Length373
Forward cDNA Template Probeshow
CATTAGTACAGCACACACAAATACTCATTCTACTGGGGGCTTTCCACAGCTCTCCACCTCATCCCAGGGTGACAAGTAA
ATGGATGTTTTTACTCTCTTACATAAATTCTTGTGCACACAACATCATCAGCACCAAAGGTCAAAATCAGCTCATCATT
AGCTAATTCTCGAGTCCAGTATGTTTTAGGACCATCTCCCTCAATAAGAGTTTGTTTGCAATAGATCTTGTTTTCATTC
TCCCAGGTGGCCAAACTCCTGCATTTTCGGCCATCCACCGTCTCCTCCTCGAAGCTCTCCCCGATTTTGAAGTTGATTT
CCGTGGTGCGGACAGTGGTGGAAGTTTTTGATGTA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Area Opaca
Early Endoderm
Early Mesoderm
Extraembryonic
Extraembryonic Mesoderm
Lateral Plate Mesoderm
 
7-12
stage 7
stage 7
stage 9
stage 9
stage 12
Ear/Otic Placode
Endoderm
Extraembryonic
Lateral Plate Mesoderm
Neural Crest
Neural Plate/Tube
Spinal Cord
 
13-18
stage 14
stage 14
stage 15
stage 16
stage 16
stage 16
stage 16
stage 16
Ear/Otic Placode
Face Mesenchyme
Hindbrain
Neural Crest
Pharyngeal Arches and Clefts
Spinal Cord
Spinal Ganglia and Nerves
 
19-24
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 22
stage 23
stage 23
stage 23
stage 23
stage 23
Face Mesenchyme
Forebrain
Foregut
Hindbrain
Leg Mesenchyme
Liver
Midbrain
Neural Crest
Pharyngeal Arches and Clefts
Rhombomeres
Sclerotome
Spinal Cord
Spinal Ganglia and Nerves
Stomach
Trunk Mesenchyme
Wing Mesenchyme
 
25
stage 25
stage 25
stage 25
Cranial PNS
Face Mesenchyme
Forebrain
Foregut
Hindbrain
Leg Mesenchyme
Midbrain
Neural Crest
Pharyngeal Arches and Clefts
Spinal Cord
Spinal Ganglia and Nerves
Trunk Mesenchyme
Wing Mesenchyme
 

Entry 2

GEISHA IdCRABP1.Thompson.2010bData SourcePublication
Complete cDNA Template Probeshow
GCGCTGCTCCCAGGTGAAGGGCCGGGGGCCGGTGGGTGTGACCCGCGCTCCCCTCCGCCGCCGCGGTCCGCCCCGCTCA
CTCGGTGCCCGAGCCGCAGAGCGAGCAGCATCGCGTCCCCGCCGCCCGCCCCGCCATGCCTAACTTCGCCGGCACCTGG
AAGATGAGGAGCAGCGAGAATTTCGACGAGCTCCTCAAAGCGCTGGGTGTCAACGCCATGCTCAGGAAGGTGGCGGTGG
CGGCCGCCTCCAAACCCCACGTGGAGATCCGCCAGGACGGGGACCAGTTCTACATCAAAACTTCCACCACTGTCCGCAC
CACGGAAATCAACTTCAAAATCGGGGAGAGCTTCGAGGAGGAGACGGTGGATGGCCGAAAATGCAGGAGTTTGGCCACC
TGGGAGAATGAAAACAAGATCTATTGCAAACAAACTCTTATTGAGGGAGATGGTCCTAAAACATACTGGACTCGAGAAT
TAGCTAATGATGAGCTGATTTTGACCTTTGGTGCTGATGATGTTGTGTGCACAAGAATTTATGTAAGAGAGTAAAAACA
TCCATTTACTTGTCACCTGGGATGAGGTGGAGAGCTGTGGAAAGCCCCAGTAGAATGAGTATTTGTGTGTGCTGTTACT
AATGCGGTGTTGTATGTGACCGTGTGTGTTATATCTGAATCCATATCCTGTTAAGTGTATTCTACTTTATGTTTCATCT
CAGATGTTACTCCTTTCTCACTTTTATGCAGTCATTTTTTTGCATCTGCTTTGTATTCTGTAGTTGTCATTTGCAATGG
TTTTACCAATTATTAAACTTATTGGGCATAACACAAAAAA
CitationH. Thompson, J.S. Griffiths, G. Jeffery, I.M. McGonnell. The retinal pigment epithelium of the eye regulates the development of scleral cartilage. Dev Biol. 2010 November 1; 347(1-13): 40–52.
CopyrightCopyright © 2010 Elsevier Inc.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI (acc #NM_001030539.1 ).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19
stage 19
stage 19
stage 19
Face Mesenchyme
Midbrain
Neural Crest
Pharyngeal Arches and Clefts
 

Entry 3

GEISHA IdCRABP1.Wilson.2007Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCGCTGCTCCCAGGTGAAGGGCCGGGGGCCGGTGGGTGTGACCCGCGCTCCCCTCCGCCGCCGCGGTCCGCCCCGCTCA
CTCGGTGCCCGAGCCGCAGAGCGAGCAGCATCGCGTCCCCGCCGCCCGCCCCGCCATGCCTAACTTCGCCGGCACCTGG
AAGATGAGGAGCAGCGAGAATTTCGACGAGCTCCTCAAAGCGCTGGGTGTCAACGCCATGCTCAGGAAGGTGGCGGTGG
CGGCCGCCTCCAAACCCCACGTGGAGATCCGCCAGGACGGGGACCAGTTCTACATCAAAACTTCCACCACTGTCCGCAC
CACGGAAATCAACTTCAAAATCGGGGAGAGCTTCGAGGAGGAGACGGTGGATGGCCGAAAATGCAGGAGTTTGGCCACC
TGGGAGAATGAAAACAAGATCTATTGCAAACAAACTCTTATTGAGGGAGATGGTCCTAAAACATACTGGACTCGAGAAT
TAGCTAATGATGAGCTGATTTTGACCTTTGGTGCTGATGATGTTGTGTGCACAAGAATTTATGTAAGAGAGTAAAAACA
TCCATTTACTTGTCACCTGGGATGAGGTGGAGAGCTGTGGAAAGCCCCAGTAGAATGAGTATTTGTGTGTGCTGTTACT
AATGCGGTGTTGTATGTGACCGTGTGTGTTATATCTGAATCCATATCCTGTTAAGTGTATTCTACTTTATGTTTCATCT
CAGATGTTACTCCTTTCTCACTTTTATGCAGTCATTTTTTTGCATCTGCTTTGTATTCTGTAGTTGTCATTTGCAATGG
TTTTACCAATTATTAAACTTATTGGGCATAACACAAAAAA
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_001030539.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-28
stage 26
stage 26
stage 26
stage 26
stage 28
stage 28
Hindbrain
Rhombomeres
 

Entry 4

GEISHA IdCRABP1.Bandyopadhyay.2008Data SourcePublication
Complete cDNA Template Probeshow
GCGCTGCTCCCAGGTGAAGGGCCGGGGGCCGGTGGGTGTGACCCGCGCTCCCCTCCGCCGCCGCGGTCCGCCCCGCTCA
CTCGGTGCCCGAGCCGCAGAGCGAGCAGCATCGCGTCCCCGCCGCCCGCCCCGCCATGCCTAACTTCGCCGGCACCTGG
AAGATGAGGAGCAGCGAGAATTTCGACGAGCTCCTCAAAGCGCTGGGTGTCAACGCCATGCTCAGGAAGGTGGCGGTGG
CGGCCGCCTCCAAACCCCACGTGGAGATCCGCCAGGACGGGGACCAGTTCTACATCAAAACTTCCACCACTGTCCGCAC
CACGGAAATCAACTTCAAAATCGGGGAGAGCTTCGAGGAGGAGACGGTGGATGGCCGAAAATGCAGGAGTTTGGCCACC
TGGGAGAATGAAAACAAGATCTATTGCAAACAAACTCTTATTGAGGGAGATGGTCCTAAAACATACTGGACTCGAGAAT
TAGCTAATGATGAGCTGATTTTGACCTTTGGTGCTGATGATGTTGTGTGCACAAGAATTTATGTAAGAGAGTAAAAACA
TCCATTTACTTGTCACCTGGGATGAGGTGGAGAGCTGTGGAAAGCCCCAGTAGAATGAGTATTTGTGTGTGCTGTTACT
AATGCGGTGTTGTATGTGACCGTGTGTGTTATATCTGAATCCATATCCTGTTAAGTGTATTCTACTTTATGTTTCATCT
CAGATGTTACTCCTTTCTCACTTTTATGCAGTCATTTTTTTGCATCTGCTTTGTATTCTGTAGTTGTCATTTGCAATGG
TTTTACCAATTATTAAACTTATTGGGCATAACACAAAAAA
CitationBandyopadhyay A, Kubilus JK, Crochiere ML, Linsenmayer TF, Tabin CJ. Identification of unique molecular subdomains in the perichondrium and periosteum and their role in regulating gene expression in the underlying chondrocytes. Dev Biol. 2008 Sep 1;321(1):162-74. doi: 10.1016/j.ydbio.2008.06.012. Epub 2008 Jun 16.
CopyrightCopyright © 2013 Elsevier B.V. All rights reserved.
CommentsAs insufficient information is provided in publication to verify exact sequence used to synthesize probe, the sequence below was obtained from NCBI NM_001030539.1
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
31-38
stage 38
stage 38
stage 38
stage 38
Leg Bones
Leg Mesenchyme
 

Entry 5

GEISHA IdCRABPL.Gustafson.2000Data SourcePublication
Complete cDNA Template Probeshow
GCGCTGCTCCCAGGTGAAGGGCCGGGGGCCGGTGGGTGTGACCCGCGCTCCCCTCCGCCGCCGCGGTCCGCCCCGCTCA
CTCGGTGCCCGAGCCGCAGAGCGAGCAGCATCGCGTCCCCGCCGCCCGCCCCGCCATGCCTAACTTCGCCGGCACCTGG
AAGATGAGGAGCAGCGAGAATTTCGACGAGCTCCTCAAAGCGCTGGGTGTCAACGCCATGCTCAGGAAGGTGGCGGTGG
CGGCCGCCTCCAAACCCCACGTGGAGATCCGCCAGGACGGGGACCAGTTCTACATCAAAACTTCCACCACTGTCCGCAC
CACGGAAATCAACTTCAAAATCGGGGAGAGCTTCGAGGAGGAGACGGTGGATGGCCGAAAATGCAGGAGTTTGGCCACC
TGGGAGAATGAAAACAAGATCTATTGCAAACAAACTCTTATTGAGGGAGATGGTCCTAAAACATACTGGACTCGAGAAT
TAGCTAATGATGAGCTGATTTTGACCTTTGGTGCTGATGATGTTGTGTGCACAAGAATTTATGTAAGAGAGTAAAAACA
TCCATTTACTTGTCACCTGGGATGAGGTGGAGAGCTGTGGAAAGCCCCAGTAGAATGAGTATTTGTGTGTGCTGTTACT
AATGCGGTGTTGTATGTGACCGTGTGTGTTATATCTGAATCCATATCCTGTTAAGTGTATTCTACTTTATGTTTCATCT
CAGATGTTACTCCTTTCTCACTTTTATGCAGTCATTTTTTTGCATCTGCTTTGTATTCTGTAGTTGTCATTTGCAATGG
TTTTACCAATTATTAAACTTATTGGGCATAACACAAAAAA
CitationGustafson AL, Mason I. Expression of receptor tyrosine phosphatase gamma during early development of the chick embryo. Mech Dev. 2000 Nov;98(1-2):183-6.
CopyrightCopyright © 2000 Elsevier Science Ireland Ltd.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_001030539).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-24
stage 21
stage 21
stage 21
stage 21
Hindbrain
Neural Plate/Tube
CRABP1(RED)
RPTPγ (BLUE)
31-44
stage 44
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4546

Mouse

EmageMGI:88490
EurexpressMGI:88490
MGI GXDMGI:88490

Frog

Xenbase962770

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-020320-3, ZDB-GENE-040624-3
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona