GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LDB3
LIM domain binding 3

Gene
Official SymbolLDB3
Official Full NameLIM domain binding 3
CGNC ID52001
also known asLIM domain-binding protein 3
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_003641476
PolypeptideXP_003641524
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human
Mouse
Xenopus
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene423610
Ensembl Gene
KEGGgga:423610

Entry 1

GEISHA IdChEST161g1Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
ACCCGACTGAACAGTGCCTTGCTGGCTTGTGAGAGAGGTACAGAATGGCTTACAGTGTGACTCTGAATGGACCTGGACC
ATGGGGCTTCCGACTGCAAGGGGGCAAGGACTTCAACATGCCCTTGACGATCTCTAGAATCACCCCTGGCAGCAAGGCA
GCACAGTCACAGATGAATCAAGGGGACCTTGTGGTAGCCATTGATGGAGTCAATACTGACAGCATGACTCACTTAGAGG
CTCAGAACAAGATCAAGTCAGCCAATTACAACCTGAGCCTCACTCTTCAGAAATCAAAACGTCCAGTGCCAGTTTCAAC
CACACCACCCAAAATTGACTCACCCAGAGCTGTAATTCCCCACCAGAAGGTTATAACCAACACCACTTCCAACACGGAT
TTCACGGAGCGTTTCAACCCCAGTGTCCTGAAGGACTCTGCCCTATCTACACACAAACCCATTGAGGTGAAAGGCCTAG
GCGGCAAGGCTACTATAATTCACGCCCAGTATAACACCCCAATCAGCATGTATTCCCAAGATGCCATCATGGATGCAAT
TGCAGGCCAGGCACAAGCCCAAGGTGGAGAATTTGCTGGTACCCTTCCTATTAAAGATCCTCACGTAGACAGTGCATCT
CCGGTGTATCAGGCTGTTCTCAAAACTCAGAACAAGCCTGAAGATGAAACTGAAGACTGGGGCCGCCGTTCTGCCAACC
TGCAGTCCAAGTCTTTTCGCATCCTTGCCCAGATGACTGGAACGGAGTTCATGCAAGATCCGGATGAAGAAGCCCTAAG
GAGATCAAGGGAAAGGTTTGAAACGGAACGTAACAGCCCACGCTTTTGCCAATTGCGCAACTGGCATCAC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Heart Tube
 
13-18
stage 14
stage 15
Heart Tube
 
19-21
stage 21
Allantois
Atria
Myotome
Outflow Tract
Ventricles
 

Entry 2

GEISHA IdLDB3.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerCACAGTCACAGATGAATCAAGGGG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGTGGGCAAGGATGCGAAAAGcDNA Template Length583
Forward cDNA Template Probeshow
AATGGACGCAGGGTGGCAGAACGGCGGCCCCAGTCTTCAGTTTCATCTTCAGGCTTGTTCTGAGTTTTGAGAACAGCCT
GATACACCGGAGATGCACTGTCTACGTGAGGATCTTTAATAGGAAGGGTACCAGCAAATTCTCCACCTTGGGCTTGTGC
CTGGCCTGCAATTGCATCCATGATGGCATCTTGGGAATACATGCTGATTGGGGTGTTATACTGGGCGTGAATTATAGTA
NCCTTGCCGCCTAGGCCTTTCACCTCAATGGGTTTGTGTGTAGATAGGGCAGAGTCCTTCANGACACTGGGGTTGAAAC
GCTCCGTGAAATCCGTGTTGGAAGTGGTGTTGGTTANAACCTTCTNGTGGGGAATTACAGCTCTGGGTGAGTCAANTTT
GGGTGGTGTGGTTGAAACTGGCACTGGACGTTTTGATTTCTGAANANTGAGGCTCANGTTGNAATTGNCTGACTTGATC
TTGTTCTGAGCCTCNAAGTNANTCATGCTGNCNNTATTGACTCCATCANTGGCTACCACANNGTCCCCTTGATNC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 7
stage 10
stage 10
stage 10
stage 10
stage 12
Atria
Heart
Outflow Tract
Unlabeled
Ventricles
No expression through stage 7
13-18
stage 14
stage 14
stage 17
stage 17
stage 17
Atria
Heart
Outflow Tract
Sinus Venosus
Ventricles
 
19-24
stage 23
stage 23
stage 23
stage 23
Aorta
Atria
Endocardium
Heart
Myocardium
Myotome
Neural Plate/Tube
Outflow Tract
Sinus Venosus
Ventricles
 
25
stage 25
stage 25
stage 25
stage 25
Aorta
Atria
Cranial Ganglia
Endocardium
Heart
Myocardium
Myotome
Outflow Tract
Sinus Venosus
Spinal Ganglia and Nerves
Ventricles
 

Entry 3

GEISHA IdLDB3.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
GCACGACTGAACAGTGCCTTGCTGGCTTGTGAGAGAGGTACAGAATGGCTTACAGTGTGACTCTGAATGGACCTGGACC
ATGGGGCTTCCGACTGCAAGGGGGCAAGGACTTCAACATGCCCTTGACGATCTCTAGAATCACCCCTGGCAGCAAGGCA
GCACAGTCACAGATGAATCAAGGGGACCTTGTGGTAGCCATTGATGGAGTCAATACTGACAGCATGACTCACTTAGAGG
CTCAGAACAAGATCAAGTCAGCCAATTACAACCTGAGCCTCACTCTTCAGAAATCAAAACGTCCAGTGCCAGTTTCAAC
CACACCACCCAAAATTGACTCACCCAGAGCTGTAATTCCCCACCAGAAGGTTATAACCAACACCACTTCCAACACGATT
TCACGGAGCGTTTCAACCCCAGTGTCCTGAAGGACTCTGCCCTATTTACACACAAACCCATTGAGGTGAAAGGCCTAGG
CGGCAAGGCTACTATAATTCACGCCCAGTATAACACCCCAATCAGCATGTATTCCCAAGATGCCATCATGGATGCAATT
GCAGGCCAGGCACAAGCCCAAGGTGGAGAATTTGCTGGTACCCTTCCTATTAAAGATCCTCACGTAGACAGTGCATCTC
CGGTGTATCAGGCTGTTCTCAAAACTCAGAACAAGCCTGAAGATGAAACTGAAGACTGGGGCCGCCGTTCTGCCAACCT
GCAGTCCAAGTCTTTTCGCATCCTTGCCCAGATGACTGGAACGGAGTTCATGCAAGATCCGGATGAAGAAGCCCTAAGG
AGATCAAGGGAAAGGTTTGAAACGGAACGTAACAGCCCACGCTTTGCCAAATTGCGCAACTGGCATCACGGCCTGTCGG
CGCAAATCCTTAATGTTAAAAGTTAAAAGCCCACATTCAGTGGGCAGATATGTGAGAAAGAATTACAGTAAAGAAATAA
CTGCTATCCTGAGTTAGAGCCTAAGAGTGTAACACACGTTCAGGAAAGATGATTGCTAGGTTGTTTTTATTTTTTCTGA
GTGCCTGTCTTTGGTAGATTTCTGTTGTTAGCCTGGAATCCACTCACTGTCACCAAAAGCAAAGATAATCATACAGCCT
TGTTCACGTTCTTTGGTACAAAGTAGATT
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST299f15. Related paper: Anderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 12
stage 12
stage 12
stage 12
stage 12
Atria
Endocardium
Outflow Tract
Ventricles
section 14
section 36
section 6

Entry 4

GEISHA IdLDB3.Anderson.2019Data SourcePublication
Complete cDNA Template Probeshow
CCCAGCACGACTGAACAGTGCCTTGCTGGCTTGTGAGAGAGGTACAGAATGGCTTACAGTGTGACTCTGAATGGACCTG
GACCATGGGGCTTCCGACTGCAAGGGGGCAAGGACTTCAACATGCCCTTGACGATCTCTAGAATCACCCCTGGCAGCAA
GGCAGCACAGTCACAGATGAATCAAGGGGACCTTGTGGTAGCCATTGATGGAGTCAATACTGACAGCATGACTCACTTA
GAGGCTCAGAACAAGATCAAGTCAGCCAATTACAACCTGAGCCTCACTCTTCAGAAATCAAAACGTCCAGTGCCAGTTT
CAACCACACCACCCAAAATTGACTCACCCAGAGCTGTAATTCCCCACCAGAAGGTTATAACCAACACCACTTCCAACAC
GATTTCACGGAGCGTTTCAACCCCAGTGTCCTGAAGGACTCTGCCCTATTTACACACAAACCCATTGAGGTGAAAGGCC
TAGGCGGCAAGGCTACTATAATTCACGCCCAGTATAACACCCCAATCAGCATGTATTCCCAAGATGCCATCATGGATGC
AATTGCAGGCCAGGCACAAGCCCAAGGTGGAGAATTTGCTGGTACCCTTCCTATTAAAGATCCTCACGTAGACAGTGCA
TCTCCGGTGTATCAGGCTGTTCTCAAAACTCAGAACAAGCCTGAAGATGAAACTGAAGACTGGGGCCCGCGTTCTGGCA
ACCTGCGAGTCCAAGTCTTTTCGCATCCTTGCCCAGATGACTTGGAAACGGAGTTCATGGCAAGATCCGGAATGAAGAA
AGGCCTAAGGAGGATCAAGGGACAGGTTTGAACGGAACGTAACAGCCCAGGCTTGGCCAATTGCGCACCTGGCATCACG
GCTGTCAGGGCCAAATCTTTATGTTAACAGTTAAAAGCCCACATTCAGGGGGGCGAATATTG
CitationAnderson C, Hill B, Lu HC, Moverley A, Yang Y, Oliveira NMM, Baldock RA, Stern CD. A 3D molecular atlas of the chick embryonic heart. Dev Biol. 2019 Dec 1;456(1):40-46. doi: 10.1016/j.ydbio.2019.07.003. Epub 2019 Jul 5.
CopyrightCopyright © 2019 Elsevier Inc. All rights reserved.
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Anderson et al. 2019.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 12
Atria
Outflow Tract
Ventricles
 

Mouse

Emage
Eurexpress
MGI GXD

Frog

Xenbase

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona