GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

LMO7
LIM domain 7

Gene
Official SymbolLMO7
Official Full NameLIM domain 7
CGNC ID12702
also known asLIM domain only protein 7, LIM domain only protein 7 (LOMP) , F-box only protein 20, LOMP
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_417010
PolypeptideXP_417010
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.50823
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human4008ENSG00000136153MIM:604362
Mouse380928ENSMUSG00000033060All phenotypic alleles (4):Targeted, knock-out(2) Targeted, other(2) MGI:1353586
Xenopus100216219, 100190776949055
Zebrafish553341, 558333ENSDARG00000004930, ENSDARG00000053535ZDB-GENE-030219-74, ZDB-GENE-060825-242ZFIN:ZDB-GENE-030219-74, ZFIN:ZDB-GENE-060825-242
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene418815
Ensembl GeneENSGALG00000016920
KEGGgga:418815

Entry 1

GEISHA IdChEST163e19Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CCGGCGGAGGATTGACCGCCCGCCACCCGCTCTTTCTCCCGGCCATGGACGGCAGAGAGGATGCCGAGTGCGGCTGCGA
GGCGGCGTTCGCAGAGGCGCGGAGATGGGTGGAGACAGTTACTGGGAAGAGCTTTGGAACCAAAGATTTTCGAGCAGCT
CTAGAAAATGGAGTCCTGTTGTGCGATTTGATTAACAAGATCAAACCTGGCATTGTTAGGAAGATCAATCGTCTGTCAA
CTCCAATAGCTGGCTTGGATAATATAAATGTTTTTCTGAAAGCTTGTGAAAATATTGGATTGAAAGAAGCTCAACTTTT
TCATCCAGGAGACCTTCAGGATTTGTCCAATCGAGTTACAGTCAAACCAGAGGAGACCAACAGAAGAGTGAAAAACGTT
TTGATTACACTATATTGGCTTGGGAGAAAAGCACAAAGTAACCCTTACTATAATGGTCCATATCTCAATCTTAAAGCAT
TTGAGAAATTATTAGGGCAAGCACTGACTAAGGCACTTGAAGAGTCCAGCCACCTAAACAGAAGTGGCAGGGATAGTGG
GTACGGTGATATTTGGTACGTGGACCGAGGGGAACCCTTTCCATCTTCAGCAAGCCACAAAAGAGACGATTCTTTGGAT
AGCTTAGACTCTCTTGGCTCAAGGTCCTCCACAAGCTTTTCATCAGACATAACCTTGAAAGGTGGCATTGAAGGCTGTG
ATAGTGACACAGACTCAGAACTGCCTTTCAAGATGCGTGACTCCCATAAAGATGACAGGTCCTATCGAAGGATTTCTGT
AATTGAACCAAAACCTGCTACTGACTTCAATCGCTTCTTACCCACCAAAAACAAGCAGCCCACTTATATGCCAGCACC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Area Opaca
 
4-6
stage 5
Hensen's Node
 
7-12
stage 7
stage 9
stage 10
Anterior Intestinal Portal
Head Mesenchyme
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Somites
Unlabeled
extraembryonic mesoderm
 
13-18
stage 16
stage 17
stage 17
stage 17
Anterior/Second Heart Field
Foregut
Head Mesenchyme
Lung
Mesonephros
Neural Plate/Tube
Notochord
Paraxial Mesoderm
Pharyngeal Arches and Clefts
Pharynx
Sclerotome
Splanchnic Mesoderm
 
19-20
stage 19
stage 19
stage 19
stage 20
Allantois
Foregut
Gut
Head Mesenchyme
Hindgut
Limb Buds
Midgut
Notochord
Pharyngeal Arches and Clefts
Sclerotome
Splanchnic Mesoderm
 

Entry 2

GEISHA IdLMO7.Anderson.2021Data SourceDirect Submission
Complete cDNA Template Probeshow
AGCACACTTGCTGGCCAAGGGAAGAAGAAAGGAGGCTTCAGGAGGAAGAAGAAGCAGCCCTGCGTTTTGAGCGAGAAAG
GGAACTCCAAGAACTAGAGCTTGAGAGACGACGTAAAGAGAGGGAACAGCAGTATGCTGAGGAGCAGAGGCGGCAGGCA
GAGATGGAGGAGCAGCAGGCGGCAGGCAGAGATGGAGGAGCAGAGGCGGCGGGCAGAGATGGAGGAGCAGAGGCAGCAA
GCAGAACGGCAGAAGGAAATGTCAGTGGAGACATCTCAATACCAAAGACGTTATGAGCGCTATGAGGTATCTAAAAGCA
ACAGAGAACCGATCTGGCCAACCTCTCATTGACAGGCATTATGAACGCTATGAATCTTCCAAAACCATCGAGGAGCGAC
CTGGTCAGTCATTTTCTGACAGGAATAAATCTAAGTCAACTTCAGAGCTGACATGAATTCAGTGCAAACAGAAATAGTA
CTCAGAGCAAGCATTCAGAGAGGTCTTGGAACACGAGTGAGTCACAGAAGGGGTCTCAGAACGGAGCACAATCTGTCTG
CAGCAGAGTTAGAGAGACAACAAATCCTTCAGGAAATGAGGACAGAACACATCTCTACACACGGACAGCAGCTGGATTA
GGCAACGCAGTTCCAGTGTGCATAAGGAGCCCATCAGTCTGCA
CommentsImages and probe sequence provided by Claire Anderson. The probe was synthesized from cDNA clone ChEST860d14. Related paper: Anderson C, Khan MAF, Wong F, Solovieva T, Oliveira NMM, Baldock RA, Tickle C, Burt DW, Stern CD. A strategy to discover new organizers identifies a putative heart organizer. Nat Commun. 2016 7:12656. doi: 10.1038/ncomms12656. 
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Unlabeled
 
4-6
stage 5
stage 6
stage 6
Hensen's Node
Neural Plate/Tube
Notochord
 
7-12
stage 7
stage 9
stage 10
stage 11
stage 12
stage 12
stage 12
Anterior Intestinal Portal
Aorta
Endoderm
Head Mesenchyme
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Pharynx
Sclerotome
Spinal Cord
Splanchnic Mesoderm
Ventricles
extraembryonic mesoderm
HH12+, ventral view
13-18
stage 13
stage 14
stage 14
stage 14
Aorta
Blood Islands
Head Mesenchyme
Lateral Plate Mesoderm
Neural Plate/Tube
Notochord
Outflow Tract
Pharyngeal Arches and Clefts
Pharynx
Tail
Ventricles
ventral view
19-24
stage 21
stage 24
Blood Vessels
Dermomyotome
Leg Mesenchyme
Neural Plate/Tube
Pharyngeal Arches and Clefts
Spinal Cord
Spinal Ganglia and Nerves
Ventricles
Wing Mesenchyme
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.50823

Mouse

EmageMGI:1353586
EurexpressMGI:1353586
MGI GXDMGI:1353586

Frog

Xenbase949055

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030219-74, ZDB-GENE-060825-242
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona