GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

EOMES
eomesodermin

Gene
Official SymbolEOMES
Official Full Nameeomesodermin
CGNC ID8681
also known aseomesodermin homolog
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
Gallus-Browse
Sequence Information
Genomic
RNAXM_426003
PolypeptideXP_426003
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST Profile
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human8320ENSG00000163508MIM:604615
Mouse13813ENSMUSG00000032446All phenotypic alleles (10):Targeted, knock-out(3) Targeted, other(7) MGI:1201683
Xenopus100038065, 398065479768
Zebrafish64603, 799447ENSDARG00000006640, ENSDARG00000019428ZDB-GENE-001228-1, ZDB-GENE-070318-1ZFIN:ZDB-GENE-001228-1, ZFIN:ZDB-GENE-070318-1
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene428443
Ensembl Gene
KEGGgga:428443

Entry 1

GEISHA IdChEST194g13Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
TCCATAGGGCGATGGAGCTCCCCGCGGTGGCGGCCGCGGCTCGAGCGAGCAATGAAAATCCNTTANACATGAAATGTGA
GGACATTAATGCTGAGGACTATACCAAAGACACTTCAAAAGGCATGGGCTACTATGCGTTCTATACCAGTTCTTAAAGC
ATCCTTTTGTTCCAATTGGCTATTTTTTTTCAGGGTGGCCTTTGTTTTCTTTCTTTTGCATTACGATTGCCAAAAAGAC
TCTTGCCTTCCACCTTAAATTGTCATGTGCAATTCTAAAGAAGGTGCCAAAGCTTTTTGACTGTTGCAGGTAATTAAGT
AGGAAAAGCAAATCATGATACAACTTTTCTTAGAAACAGGATGTGGAAAAGCTGTAAGCAGGAGCCTAGATTTCTACAA
GGTGGTTTATTTATTGGAGACACTGAAGTGTACAGTTTGGCTTGGCCCAGAGGCCTGATCAAATCTGTACACTGAGTGA
GGAAATAGCAGTTGGATTCCAAATTTTACTTTCTTCCCTGCCTTGCCCCTCTGGTAAAGGGCACCGGGGTGGGGGGCTG
CACATTCTGTTTTAAACAGAACTGTTTTCTTCAACACTTGTTCACAGAGCAGTTGGCTGAGTTAGGCATTGCTCAGCTA
AGGCTTTCTTTGGTAGAAGGTGGTTAAAATAAGGCCTGCTCCAGGCAGGAATTTAACTTGAAGGTCTTGCTGCTAGTGA
TGCCTTTACAATGGCCAAATCTGACTTTTAAGGAAAACATGCCTCCATCCCAAAAGCCTAACCCTTATTGAGGTGGCAA
AAAAATCCAAGTGTACAGTTGTGTTTTGTCTAGGTACACTGTAGAACATTGTGAAATAATATATAAATAGTTGACCTAT
AGCTGTTCAGTCAGAAGGACCTCCGGTGGTGCTTTGAAGTTCAAAATGCATTTTCTTTTTTGGGTTAAACTTAGCATAT
GGAGCATTGCAAAGAGCATTAGCAGATTTCTATTTGCGTGTATGTAAAGTGACTTTCAGCTGCCCTGTATCAAACTGGA
AGTGATGTAACCTGCCCACTCTTCTTGCCTATAGTTTCAGCCATTTTAAACGGATCAACCCTAGAGCACTGGCACACAC
AATTCTCCTGGTGAAANCTTGGTTCCGCTTTTATATGTACATAGTAGTAATTTTTAATNNTTAAAAGGGTGCCTTGCAA
AAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
Epiblast
Hensen's Node
Primitive Streak
 
4-6
stage 4
stage 5
stage 6
Epiblast
Headfold
Neural Plate/Tube
Notochord
Primitive Streak
 
7-12
stage 7
stage 8
stage 9
stage 10
stage 11
stage 12
Anterior Neuropore
Forebrain
Headfold
Hindbrain
Midbrain
Neural Plate/Tube
Notochord
Low level expression.
Low level expression.
13-18
stage 13
stage 17
Forebrain
Hindbrain
Midbrain
Notochord
 
19-24
stage 22
stage 23
stage 24
stage 24
Cranial Ganglia
Telencephalon
 
25
stage 25
Telencephalon
 

Entry 2

GEISHA IdEOMES.Pernaute.2010Data SourcePublication
Complete cDNA Template Probeshow
TGACTGAAGATGGCGTTGAGGATCTGAATGATTCTTCAAAGACTCAAACGTTTATTTTCCCCGAAACGCAGTTCATAGC
AGTTACAGCCTATCAAAACACCGATATTACTCAGCTCAAAATTGATCACAATCCTTTTGCAAAGGGCTTCAGAGACAAC
TATGACTCATCCCACCAGATTGTCCCTGGTGCCCGATACAGCGTGCAACCGTTCTTCCAAGAACAGTTTGTCAACAACC
TGCCCCCCACCAGATTTTACAACGGTGAGAGAACCGTCCCGCAGACCAACGGCTTGCTGTCCCCACAGCAGAGCGAAGA
GGTGGCCAGCCCTCCCCAGCGGTGGTTCGTTACTCCCGTGCAGCAGCCCAGTGCCAACAAACTGGACATGAACTCCTAT
GAGACGGAGTACTCTCCTAGCACCTTGCTCCCCTACGGCATTAAATCCCTCCCTCTTCAGACATCCCATGCCCTGGGGT
ACTACCCTGACCCAACGTTTCCATCCATGGCGGGCTGGGGGAGTAGGGGCTCCTACCAGAGAAAAATGACCACAGGATT
ACCTTGGAGCTCCAGGACAAGTCCTCCAGGCTTCTCTGAAG
CitationPernaute B, Cañon S, Crespo M, Fernandez-Tresguerres B, Rayon T, Manzanares M. Comparison of extraembryonic expression of Eomes and Cdx2 in pregastrulation chick and mouse embryo unveils regulatory changes along evolution. Dev Dyn. 2010 Feb;239(2):620-9. doi: 10.1002/dvdy.22176.
CopyrightCopyright © 2009 Wiley-Liss, Inc.
CommentsThe cDNA template used to generate the probe was obtained by PCR as described in the paper.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
X-XIV
stage X
stage XII
stage XIV
Area Opaca
Hypoblast
Kohler's Sickle
 
1-3
stage 1
stage 2
Area Opaca
Primitive Streak
 
4-6
stage 4
stage 4
stage 4
stage 5
Epiblast
Germ Cells/PGCs
Headfold
Hensen's Node
Primitive Streak
 
19-22
stage 19
stage 19
stage 22
Forebrain
Germ Cells/PGCs
 

Entry 3

GEISHA IdEOMES.Han.2018Data SourcePublication
Complete cDNA Template Probeshow
TGACTGAAGATGGCGTTGAGGATCTGAATGATTCTTCAAAGACTCAAACGTTTATTTTCCCCGAAACGCAGTTCATAGC
AGTTACAGCCTATCAAAACACCGATATTACTCAGCTCAAAATTGATCACAATCCTTTTGCAAAGGGCTTCAGAGACAAC
TATGACTCCATGTACACAGCTTCAGAAAATGACAGATTAACTCCATCTCCCACGGATTCTCCTAGATCCCACCAGATTG
TCCCTGGTGCCCGATACAGCGTGCAACCGTTCTTCCAAGAACAGTTTGTCAACAACCTGCCCCCCACCAGATTTTACAA
CGGTGAGAGAACCGTCCCGCAGACCAACGGCTTGCTGTCCCCACAGCAGAGCGAAGAGGTGGCCAGCCCTCCCCAGCGG
TGGTTCGTTACTCCTGTGCAGCAGCCCAGTGCCAACAAACTGGACATGAACTCCTATGAGACGGAGTACTCTCCTAGCA
CCTTGCTCCCCTACGGCATTAAATCCCTCCCTCTTCAGACATCCCATGCCCTGGGGTACTACCCTGACCCTACGTTTCC
ATCCATGGCGGGCTGGGGGAGTAGGGGCTCCTACCAGAGAAAAATGACAACAGGATTACCTTGGAGCTCCAGGACAAGT
CCTCCAGGCTTCTCTGAAG
CitationJae Yong Han, Hyo Gun Lee, Young Sun Hwang, Hyung Chul Lee, Sang Kyung Kim, Deivendran Rengaraj. Expression of transcription factors during area pellucida formation in intrauterine chicken embryos. Int J Dev Biol. 2018;62(4-5):341-345. DOI: 10.1387/ijdb.170255jh.
CopyrightCopyright © UPV/EHU Press
CommentsThe complete cDNA template sequence was obtained from the information from the publication as described in Han et al. 2018.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
stage 3
stage 3
Area Pellucida
 
4-6
stage 5
stage 6
Area Opaca
Area Pellucida
Hypoblast
 
all
 
 
  

Mouse

EmageMGI:1201683
EurexpressMGI:1201683
MGI GXDMGI:1201683

Frog

Xenbase479768

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-001228-1, ZDB-GENE-070318-1
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona