GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

MTA1
metastasis associated 1

Gene
Official SymbolMTA1
Official Full Namemetastasis associated 1
CGNC ID53548
also known asmetastasis-associated protein MTA1, hypothetical protein LOC429060
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001012953
PolypeptideNP_001012971
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.19448
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly40693FBgn0027951
Human9112ENSG00000182979MIM:603526
Mouse116870ENSMUSG00000021144All phenotypic alleles (3):Targeted, other(2) Gene trapped(1) MGI:2150037
Xenopus496581, 4477581007625
Zebrafish794477ENSDARG00000007198
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene429060
Ensembl GeneENSGALG00000002803
KEGGgga:429060
GEISHA IdChEST282k3Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
TCCTCTTCTGACATACGGAGAGCTAGAACCCTTCTTTTGTGACCGAGCTCTCGTTGCGAAGCCGTTTTTACGAGGCTGT
GTTGTAAGTTTGGGTTTGTTTTGTTTTGTTTTTGTTTTTTAATTTTGTGGACGGTGCCATTTTTTATTTCATTTATATG
ATTTCTTTTGTAGATACATTTCCAACCTCTATCAGATATCTGCTCGTAGGAGCTGGGAGCCAGCCCCGGGTTCAGCCTG
TTTGCTTTGGTCCTGCCCCTTATGTTTTTTGGATCATTTTTCGCGGCCAGTTGTGCTCCTGCACCAGACAGAAACAACT
CAGGCTGAGAAAGGAGTGAGCTAAGAACGGAAGAACCTTGCAGAGCGTTACGCTAACGGTGTGTGCAATGGAGGCCAGG
CTGCCGGAGTTGGGTGCCCTTGCTCTATCCATCCCTGGGAGATGTGGCTCATAGCACTTCTCTCTGCGACCAGCAGTTT
GCGCGCTGCCTTCTCTCTGACATCTGGAGCCCTACGTGCTGCCGTGCCACCCGCAGCCAGCAGTAGGCCCAGCAGTGTA
ATGAATTGCTTTGCTCTGGCTCCAAGAGTCAAGTACACCAATGCCCAGGGACGTTTTGCTT
CommentsNo specific expression detected for stages 15-21.
no images
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.19448

Mouse

EmageMGI:2150037
EurexpressMGI:2150037
MGI GXDMGI:2150037

Frog

Xenbase1007625

Fruit Fly

BDGPFBgn0027951

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona