GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

KLF5
Kruppel like factor 5

Gene
Official SymbolKLF5
Official Full NameKruppel like factor 5
CGNC ID12707
also known asKrueppel-like factor 5|Kruppel-like factor 5 (intestinal), Krueppel-like factor 5, Transcription factor BTEB2, BTE-binding protein 2, Intestinal-enriched krueppel-like factor, Colon krueppel-like factor, Basic transcription element-binding protein 2, GC box-binding protein 2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_417013
PolypeptideXP_417013
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.7954
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human688ENSG00000102554MIM:602903
Mouse12224ENSMUSG00000005148All phenotypic alleles (7):Targeted, knock-out(2) Targeted, other(4) Gene trapped(1) MGI:1338056
Xenopus100489339, 735138490586
Zebrafish100006043ENSDARG00000015506ZDB-GENE-080424-4, ZDB-GENE-090312-167ZFIN:ZDB-GENE-080424-4, ZFIN:ZDB-GENE-090312-167
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene418818
Ensembl Gene
KEGGgga:418818

Entry 1

GEISHA IdChEST429a18Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
TCGACATGCCCAGTGCGGCTCCTCAGGCGGCCGTCATGGACTCCCTTAGCAGTGTCTCCATGCCGTCGGCCATGTCGGG
CCTCAACACCCTCTCCCCGGCTGTCCCACAGACTGCAATGAAACAGTTCCAGGGCATTCCCCCATGCTCCTACACGATG
CCAAACCAGTTCCTTCAGCAGCAGGCCACCTACTTCCCCCCTTCACCCCCCAGCTCAGAGCCTGGCAGTCCAGACAGAC
AAGCAGAGATGCTACAGAATTTAACCCCTCCTCCATCGTACGCTGCCACTATAGCTTCCAAGCTGGCAATTCACAACCC
GAATTTACCTGCAACTCTGCCAATAACTCCCCAGAACATACAGCCAGTCAGATACAACAGGAGAAGTAACCCAGATTTG
GAGAAAAGACGCATCCACTACTGTGACTACCCCGGCTGCACAAAAGTGTATACTAAGTCTTCTCACTTAAAAGCGCACC
TGAGAACTCACACGGGTGAAAAACCATACAAGTGCACGTGGGAGGGCTGCGACTGGCGATTTGCGCGCTCGGATGAATT
AACGCGCCATTACAGGAAGCACACCGGGGCTAAACCCTTCCAGTGCGCCGTGTGCAACCGCAGCTTCTCCCGCTCCGAT
CACCTGGCTCTGCACATGAAGAGGCATCAGAACTGAAAGCCAGAGTTGTTGCCGAGGCTGTTCTGTATCTATGCAATTT
CCTAATGACTCTCAACCTACAACTAAAATTAGTTTAATTTTTTGAGGATGGATTATCCATTTAAAAGAAATCTCGAAAC
TGGAAAATGTATATTTTGTATATTTATGCAGAAAAAGGGAAGACACTGTATCACAATACAGAGTGTTCAAGTCATTTGT
TTGCT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
1-3
stage 3
Area Opaca
Epiblast
Primitive Streak
 
4-6
stage 4
stage 4
stage 4
stage 4
stage 5
stage 6
Area Opaca
Area Pellucida
Early Mesoderm
Epiblast
Headfold
Hensen's Node
Primitive Streak
 
7-12
stage 7
stage 8
stage 9
stage 9
stage 9
stage 9
stage 9
stage 9
stage 9
stage 10
stage 10
stage 10
stage 11
Amnion
Area Opaca
Early Mesoderm
Epiblast
Extraembryonic
Forebrain
Head Mesenchyme
Primitive Streak
Surface Ectoderm
Tail
Trunk Mesenchyme
Yolk Sack or Stalk
anterior neuropore
nuc
13-18
stage 14
stage 17
stage 18
Amnion
Surface Ectoderm
 
19-24
stage 20
stage 22
stage 23
Amnion
Somites
Surface Ectoderm
 
25
stage 25
Amnion
Surface Ectoderm
head

Entry 2

GEISHA IdKLF5.Antin.2010Data SourcePublication
Complete cDNA Template Probeshow
TCGACATGCCCAGTGCGGCTCCTCAGGCGGCCGTCATGGACTCCCTTAGCAGTGTCTCCATGCCGTCGGCCATGTCGGG
CCTCAACACCCTCTCCCCGGCTGTCCCACAGACTGCAATGAAACAGTTCCAGGGCATTCCCCCATGCTCCTACACGATG
CCAAACCAGTTCCTTCAGCAGCAGGCCACCTACTTCCCCCCTTCGCCCCCCAGCTCAGAGCCTGGCAGTCCAGACAGAC
AAGCAGAGATGCTACAGAATTTAACCCCTCCTCCATCGTACGCTGCCACTATAGCTTCCAAGCTGGCAATTCACAACCC
GAATTTACCTGCAACTCTGCCAATAACTCCCCAGAACATACAGCCAGTCAGATACAACAGGAGAAGTAACCCAGATTTG
GAGAAAAGACGCATCCACTACTGTGACTACCCCGGCTGCACAAAAGTGTATACTAAGTCTTCTCACTTAAAAGCGCACC
TGAGAACTCACACGGGTGAAAAACCATACAAGTGCACGTGGGAGGGCTGCGACTGGCGATTTGCGCGCTCGGATGAATT
AACGCGCCATTACAGGAAGCACACCGGGGCTAAACCCTTCCAGTGCGCCGTGTGCAACCGCAGCTTCTCCCGCTCCGAT
CACCTGGCTCTGCACATGAAGAGGCATCAGAACTGAAAGCCAGAGTTGTTGCCGAGGCTGTTCTGTATCTATGCAATTT
CCCTAATTGACTCTTCAACCTACAACTAAAAATTAGTTTACTTCTCTTGAGGATGGATTATCCATTTTACAACGAAATC
TCGAAAACTGCAACCATGTCTATTCTGGGTCTACTTTATGCCGCACCACAGGGACGACTCTGTTTCCCAATACCCGAGT
GTTCCCGTCATTTGTGTGCTCCCCTGGCTGTATAATGGCTTAGTCAGCAGGTTTCACCTCTTACCAGTTTTTTGTCCTG
CCCATGGCGCGTTCCCATCTTTTTCTCC
CitationAntin PB, Pier M, Sesepasara T, Yatskievych TA, Darnell DK. Embryonic Expression of the Chicken Krüppel-like (KLF) Transcription Factor Gene Family. Dev Dyn. 2010 Jun;239(6):1879-87.
CopyrightCopyright © 2010 John Wiley & Sons, Inc. All Rights Reserved.
CommentsProbes were prepared using the entire cDNA insert in each EST clone. KLF 5 was made using clone ChEST429a18, which is represented in genbank by BU262693.1.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
Epiblast
 
7-12
stage 8
stage 9
stage 10
stage 10
stage 11
stage 11
Dermomyotome
Lateral Plate Mesoderm
Somatic Mesoderm
Surface Ectoderm
 
13-18
stage 14
Dermomyotome
Extraembryonic
Surface Ectoderm
 
19-23
stage 23
Allantois
Amnion
Myotome
Pharyngeal Arches and Clefts
Surface Ectoderm
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.7954

Mouse

EmageMGI:1338056
EurexpressMGI:1338056
MGI GXDMGI:1338056

Frog

Xenbase490586

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-080424-4, ZDB-GENE-090312-167
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona