GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

PDLIM5
PDZ and LIM domain 5

Gene
Official SymbolPDLIM5
Official Full NamePDZ and LIM domain 5
CGNC ID51807
also known asPDZ and LIM domain protein 5, PDLIM5
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_001031149
PolypeptideNP_001026320
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.6787
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human10611ENSG00000163110MIM:605904
Mouse56376ENSMUSG00000028273All phenotypic alleles (2):Targeted, other(2) MGI:1927489
Xenopus548530, 100101292854113
Zebrafish393165, 436927ENSDARG00000027600, ENSDARG00000038267ZDB-GENE-040426-908, ZDB-GENE-040718-401ZFIN:ZDB-GENE-040426-908, ZFIN:ZDB-GENE-040718-401
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene422699
Ensembl GeneENSGALG00000012211
KEGGgga:422699
GEISHA IdChEST458h21Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCGGCTCGAGGAGGGACGGAGCTGCTGCCTGGCAGACGCGCCGCGGGTGTCTTCGTCGCTCCGCGCCCCGCAGCGCTGG
GCTGGGCATCAAGTCCTTGGCTTGGATCCTTGAATACTGAACACCATGAGCAACTACAGCGTGTCTCTGGTCGGCCCGG
CTCCTTGGGGTTTCAGGCTTCAAGGTGGCAAGGATTTCAACATGCCCCTGTCCATCTCTCGGCTTAACGACGGTGGAAA
AGCAGCCCGAGCAAACGTGGGGATTGGTGACGTGGTTCTCACCATTGATGGGATAAGTACAGACAGGATGACTCATCTA
GAAGCACAAAACAAGATCAAGGCATGTACAGGCAATCTGAACATGACTTTGCAAAGAGTGGCTTCTGCAACAAAACCTG
ATATTATTCATGTACCAAAGCCTGCCACGCACAATGCCGCCCCGGGCGGCCATGTCGGCGACAGCACCCAGGAGCTAGC
GGAGGGGCTGCGACGAGGATTCAGAGAGAACCAGGTGACAATAAACAGCAAAATGGGAAAATCCCACCCAAACGCCCCC
CACGAAAGCACATTGTGGATACCTATACGGAGTTCTATCACACCCCTACTCACAGCGATGCCAGCAAGAAGCGGCTGAT
TGAAGATACTGAAGACTGGCATCCC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 5
stage 6
Area Opaca
Germinal Crescent
Paraxial Mesoderm
Primitive Streak
 
7-12
stage 9
stage 9
stage 10
stage 11
stage 12
Atria
Blood Vessels
Head Mesenchyme
Heart Tube
Oral Pharynx
Paraxial Mesoderm
Rhombomeres
Sinus Venosus
Somites
Ventricles
Yolk Sack or Stalk
xs
13-18
stage 14
stage 17
stage 18
Ear/Otic Placcode
Head Mesenchyme
Pharyngeal Arches and Clefts
Sinus Venosus
 
19-20
stage 19
stage 20
stage 20
Atria
Sinus Venosus
Somites
Ventricles
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.6787

Mouse

EmageMGI:1927489
EurexpressMGI:1927489
MGI GXDMGI:1927489

Frog

Xenbase854113

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-040426-908, ZDB-GENE-040718-401
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona