GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ELF3
E74 like ETS transcription factor 3

Gene
Official SymbolELF3
Official Full NameE74 like ETS transcription factor 3
CGNC ID382
also known asETS-related transcription factor Elf-3|E74-like factor 3 (ets domain transcription factor, epithelial-specific ), E74-like factor 3, Epithelium-specific Ets transcription factor 1, ESE-1, Epithelium- restricted Ets protein ESX, Epithelial-restricted with serine box, ETS-related transcription factor Elf-3
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_419257
PolypeptideXP_419257
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.50458
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1999ENSG00000163435MIM:602191
Mouse13710ENSMUSG00000003051All phenotypic alleles (3):Targeted, other(3) MGI:1101781
Xenopus100144720853528
Zebrafish560869ENSDARG00000077982ZDB-GENE-030131-8760ZFIN:ZDB-GENE-030131-8760
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene421177
Ensembl GeneENSGALG00000000616
KEGGgga:421177
GEISHA IdChEST494i20Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCCGTGCGTGGCGGCGGGCAGGGCTCGCTCGCTGCTCTCTGGATTAGCCGCTGCCCAGGGATTGCCATCACAGAAGAGC
TTGATGGCGGCATCTTGTGAGATCAGCAACATCTTCTCCAACTACATCAGCGCCATGTACCAACCCGAGGAGGTGCAGC
TGCCCCCGGACGTGCTAGGACGCCCCGGGGAGGACAGCGGCATGGGGCTGAGCCTCTCCACCAGCCAACCCCTGGCAGA
GGGCACAGACAAGCCTGAGTGGTTCAGTGAGCTCCCATACTTCTGGACCAAGGTGCAGGTGCTGGAGTGGATCAGCTAC
CATGTGGAGAAGAACAAGTACGATGCCAGCTCCATTGACTTCTCCTGCTGCAACATGGATGGGCACGCGCTCTGCCACT
GCACCAGGGACCAGATGCGCCTCATCTTTGGGCCACTGGGGGATGAGCTGTATGACCGCCTGCATGAGATCACCTCCGA
TGAGCTGAGCTGGATCATCGAGCTGCTGGAGAAAGAGGATGCGAATTCCCAAGAGACCTTCCTGGACAGCAGCCACCTG
GAGCTCGGCAATCCCTGTGCCAAGGACTCCCTGGAGGACCTGAAGCCCACAAACCCCTTCCTTGCCACAGACTTCACCT
GCTTGCCCGGTGCCATGTCCCCTGGCAGCTCCGACCTCTCAGGGCCCGTGATGTCCCACAGCCCCAAAAAAAG
CommentsNo specific expression detected stage 11-13.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-21
stage 21
Amnion
Ear/Otic Placcode
Nephric Ducts
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.50458

Mouse

EmageMGI:1101781
EurexpressMGI:1101781
MGI GXDMGI:1101781

Frog

Xenbase853528

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-8760
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona