GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

OVOL2
ovo like zinc finger 2

Gene
Official SymbolOVOL2
Official Full Nameovo like zinc finger 2
CGNC ID6606
also known asOVOL3, transcription factor Ovo-like 2|ovo like zinc finger 3|ovo-like 2, Transcription factor Ovo-like 2, hOvo2, Zinc finger protein 339
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_415018
PolypeptideXP_415018
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.20279
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human58495ENSG00000125850
Mouse107586ENSMUSG00000037279All phenotypic alleles (2):Targeted, knock-out(1) Targeted, other(1) MGI:1338039
Xenopus448478854192
Zebrafish
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene416720
Ensembl Gene
KEGGgga:416720
GEISHA IdChEST525i12Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
CCCAGGCGGCCTCGGCTGCGCCCCGGGCTACGAAGACAGCTGCAGCCTGGAGAGCAGCGGCAGCAGCGGGACGCGGGAC
CCCGAGCTCGGAGACCCCCCCACGCCGCAGGCGGCCCCCGCGGAGCTGGGCGCGCCCGGGGGGATGCTGCTGGACCTGG
CCGTCAGGCGCCCCGCCGTCAGGTCGAAAATCAAGTTCACCACGGGCACCTGCACCGATGCCGCAGTGCACTCCTGCGA
GCTGTGTGGCAAGGGCTTCCGCCTGCAGCGCATGCTGAACCGGCACGTCAAGTGCCACAGCCAGGTGAAGAGGCACCTG
TGCACCTTCTGCGGGAAGGGCTTCAACGACACCTTTGATCTGAAGCGCCACGTCCGGACCCACACCGGAATTCGTCCTT
ACAAATGTGAGGTTTGCAACAAAGCATTTACCCAGCGGTGTTCCCTGGAATCCCACCTCAAGAAGATTCACGGAGTGCA
GCAGCAATACGCCTACAAACAGAGGCGAGACAAACTGTACGTGTGCGAGGATTGCGGCTACACCGGCCCCACGCAGGAG
GACCTGTACCTGCATGTCAGCAGCGTTCACCCCAGCAGTGCTTTCCTGAAAAAAACCTCAAAAAAACTCGCAGCGGTTT
TGCAAAACAAACTGAGCCCTGTCCTGCAGAGGAACTCCAAAGATGACGACAAAGATGAGTAACGCGGTGGATTACAGTG
GTCTACAGGAATGAAGTTTACACGTAGGACTACGTATATATTATTTTTTTAAAAAACCTATTTTTGAATAGATCCCTGA
AAAAAAG
Commentsno specific expression detected stages 4-23.
no images
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.20279

Mouse

EmageMGI:1338039
EurexpressMGI:1338039
MGI GXDMGI:1338039

Frog

Xenbase854192

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFIN
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona