GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

IVNS1ABP
influenza virus NS1A binding protein

Gene
Official SymbolIVNS1ABP
Official Full Nameinfluenza virus NS1A binding protein
CGNC ID3814
also known asinfluenza virus NS1A-binding protein
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_424470
PolypeptideXP_424470
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.56335
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human10625ENSG00000116679MIM:609209
Mouse117198ENSMUSG00000023150All phenotypic alleles (2):Targeted, knock-out(1) Targeted, other(1) MGI:2152389
Xenopus100145550, 446327949331
Zebrafish334334, 387591ENSDARG00000013946, ENSDARG00000031100ZDB-GENE-030131-6266, ZDB-GENE-031222-2ZFIN:ZDB-GENE-030131-6266, ZFIN:ZDB-GENE-031222-2
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene426862
Ensembl Gene
KEGGgga:426862
GEISHA IdChEST554e2Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GCGGCTCGAGGAGAGGGAGGCTTCCCGCTTTCCGCCCGGTAGCAGGCCTGACTACCCCGGGCTGCTCCACCTCCGCGCC
GGAGGCCTACGGGGCTGCGCTGCGCCCGAGCCGAGGGCTCTCCCTGCTCTAGTCGTGTCGCCTGCCTGTCGCCGTGCAG
CCGCGCTCTCCCCCCGTACCCTGTTCCCGGCGGACTCGGATTGCTTCTCCGCGTCGGCTTTCCCGCAGCCTGGAGGCTC
CCAGTATGAGCTGCATCATTCGCGCTGAGAGACAGAAGATTATGATGCACGATTATCACAGAAGAAATTCATGTCTATA
GCTTTTAAGGACTTGATTACATCATCTTCAAGCCAGATAGTTTTGGAATCCATATTGCAGCTGCAAAGACAAGTTTCCT
TTTGCACTTAAATAAACATCTTTCCTATTAGAAGATACCAAAGTGCTCTGTTTAACCACAGGGATACCACTGAAATACT
GTAAGATTTTCCAGTTACAAATTTGCGGTCGTATATTTGCTAGACCAACACCAAAATGATTCCTAATGGATATTTGATG
TTTGAAGATGAAAATTTCATCGAGTCATCTGTTGCCAAACTAAACGCCTTACGTAAAAGTGGTCAGTTCTGTGATGTCC
GACTCCAGGTATGTGGGCATGAGATGCTGGCGCACAGAGCTGTGCTAGCTTGCTGCAGTCCCTACCTGTTTGAAATCTT
CAATAGTGATAGTGATTCTCATGGAATTTCTCATGTTAAATTTGATGATCTCAATCCAGATGCTGTTGAAGTTCTTTTG
AATTATGC
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 5
Area Opaca
 
7-12
stage 8
stage 10
stage 11
Area Opaca
 
13-18
stage 13
stage 14
stage 18
Area Opaca
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.56335

Mouse

EmageMGI:2152389
EurexpressMGI:2152389
MGI GXDMGI:2152389

Frog

Xenbase949331

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-030131-6266, ZDB-GENE-031222-2
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona