GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

NCOA2
nuclear receptor coactivator 2

Gene
Official SymbolNCOA2
Official Full Namenuclear receptor coactivator 2
CGNC ID11634
also known asnuclear receptor coactivator 2, NCOA2
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_001231577
PolypeptideXP_001231578
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.9808
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human10499ENSG00000140396MIM:601993
Mouse17978ENSMUSG00000005886All phenotypic alleles (4):Targeted, knock-out(1) Targeted, other(3) MGI:1276533
Xenopus100216190, 394405482310
Zebrafish81884ENSDARG00000017929ZDB-GENE-010406-3ZFIN:ZDB-GENE-010406-3
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420176
Ensembl Gene
KEGGgga:420176

Entry 1

GEISHA IdChEST752c24Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
AAAAGAACAAGAAAAAGCAGCAGCAGCTAATGAAGATGAAGTGCAAAAAGCAGATGTGTCATCTACGGGTCAGAGTGTC
ATCGACAAGGATGCGCTTGGACCAATGATGCTTGAGGCCCTGGATGGGTTCTTCTTTGTAGTGAACCCAGAAGGTAATG
TTGTGTTTGTTTCGGAGAATGTGACGCAGTACTTAAGGTACAACCAAGAAGAGCTGATGAACACAAGCATATATAGCAT
CCTGCACGTAGGGGACCACAATGAATTTGTTAAAATCCTGCTGCCCAAATCTTTAGTGAATGGGGGATCTTGGTCTGGT
GACACTCCTAGGCGTAATAGCCATACCTTCAACTGTCGGATGCTCGTAAAACCGCTTGCTGATTCTGAAGAAGGCCATG
ATAATCAGGAAGCACATCAGAAATATGAAACTATGCAGTGCTTTGCTGTTTCTCAACCAAATTCCTTCAAGGAGGACGG
TGAAGATTTGCAGTCTTGCTTGATTTGTGTTGCAAGAAGAGCTCCAATGAAGGAAAGGCCACTTCTTCCTTCATCAGAG
AGCTTTACTACTCGCCAGGATCTACAGGGCAAAATAACTTCACTGGATACCAGTAGCATGCGAGCAGCTATGAAACCTG
GCTGGGAAGATTTGGTGAGAAGATGTATTCAGAGGTTCCATTCGCAGCATGAGGGAGAAATATCTTTTGCCAAAAGGCA
TCACCAGGAAGTGCTGAGGCAGGGACTAGCATTTAGTCCTGTTTACCGGTTTTCCTTGTCGGATGGCACTATAGTTTCT
GCCCAAACGAAGAGCAAACTCATCCGTTCCCAGACTACTAGTGAACCTCAGCTTGTCATCTCCTTGCATATGCTTCACA
GAGAGCAGAATGTCTGTGGAATGAATCAGGATTTGACTGGACAAGG
CommentsNo specific expression detected at stages 4-25.
no images

Entry 2

GEISHA IdNCOA2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template PrimerGTGTTTGTTTCGGAGAATGTGACG
Reverse cDNA Template PrimerAATTAACCCTCACTAAAGGTGTCTGGCTTTTTCCATCGTGcDNA Template Length1503
Forward cDNA Template Probeshow
CCCGCCAATTCCGTCACTATCTGGCATCAGTCCCCGCCACTAATACCGAAGGCACGCTGCTCTCACTGTTTTCTTTCTG
TTCTCCTGAATGGCACCTGCTCTCTGTTTGTCCAGTTGTACCTTCAGATTGCTCCCCATACAGTCCAAAGCAGTCTTTT
GAGTCCAGGCTTCCCATCTTGCTTAGCTGGGGAGGGTTCATATTCACAGGGGAATTTTGTAAATTTCCCATTTTTAGGT
CAGGTGAATCCAACGACGATCCTAGAGAAACTCCATGGCCCTCACTGAGGGCCTGAAGGGCATTCACGGAACTGTTGGT
GTAATTATGGCTATTTCCTGTGCTGCTGCAAACTCCCACCGGTGAATGCAAGCTTCCTGCAGGGGAGAACTGACTAAGT
GGGATTCTAGGACTGCCTGCCACTCCAGGGCTCACGCAATGCCTTGGGGAAAACATAGAGATTGGATGCCCTGGGTTCA
TGCCGGGGCTGCTTTGAGAGGGGCTATTCATTTTTAGTGCATATTTACTACCCTGAGGAGTGGATGCTTGAATACTTGA
CACCTGGTTCATTCCCCCTGAACCACCAAATCTGCCCTGCTGGCGTGCCCATTTGTTCCTTTGGGCCCTTTATGGCGAA
ATTCATATTGCTACTGCTGGTCATATCCTGACCTGGGTTCCCACAGAACATGAACCTGAGGGGCAGGGATGCTGGAGCT
AATTGGGGTGCATATCTTTCCCATTCCTTGTCCAGTCAAATCCTCATTCCTTCCCCACACATTCTGCTCTTTGTGGAGC
AAATGCAGGGAGAGGACCACCTCACGTTCACTATTTTTTTGTGAACGGATGAGTTTGCTCTTCGTTTGTGCCAAACCCA
ATAATGCTATTGGACCAGGGAAAAGAAAAAAA
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Area Pellucida
Early Mesoderm
Epiblast
Neural Plate/Tube
Primitive Streak
 
7-12
stage 7
stage 7
stage 8
stage 11
Anterior Intestinal Portal
Area Pellucida
Blood Islands
Head Mesenchyme
Headfold
Heart
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Paraxial Mesoderm
Primitive Streak
Somites
HH stage 6+ to 7-.
13-18
stage 13
stage 17
stage 18
Blood Islands
Head Mesenchyme
Heart
Intermediate Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Somites
Widespread Expression
 
19-24
stage 20
stage 21
Widespread Expression
 
25
stage 25
Widespread Expression
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.9808

Mouse

EmageMGI:1276533
EurexpressMGI:1276533
MGI GXDMGI:1276533

Frog

Xenbase482310

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-010406-3
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona