GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

ZMYND11
zinc finger MYND-type containing 11

Gene
Official SymbolZMYND11
Official Full Namezinc finger MYND-type containing 11
CGNC ID4977
also known aszinc finger MYND domain-containing protein 11|zinc finger, MYND domain containing 11, Zinc finger MYND domain-containing protein 11, Adenovirus 5 E1A- binding protein, BS69 protein
gene typeprotein-coding
Genomic Map
 Ensembl
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_418557
PolypeptideXP_418557
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.10687
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human10771ENSG00000015171MIM:608668
Mouse66505ENSMUSG00000021156All phenotypic alleles (1):Targeted, other(1) MGI:1913755
Xenopus100125090960938
Zebrafish553781ENSDARG00000057249ZDB-GENE-050522-301ZFIN:ZDB-GENE-050522-301
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420455
Ensembl GeneENSGALG00000006599
KEGGgga:420455
GEISHA IdChEST908m19Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GGAAAAATATGTGGAAGGAGGAGGCAGCAGCGGCCTGGGGAAGGGATTGAAAAGTTTCCCTTGGCTTAACTTCGCCCCC
CCTGCAGCAGCAGAAGCAGCGGCAGCAGCACAAGCTGACCAAGTAAACAGGTCATGGCACGCTTAACGAAGAGACGACA
GGCAGATACAAAGGCGATCCAACATCTTTGGGCAGCAATAGAAATAATCCGGAATCAGAAGCAAATTGCTAACATTGAC
CGTATCACAAAGTATATGTCTCGAGTCCATGGTATGCATCCAAAAGAAACCACTCGTCAGCTGAGTTTAGCAGTCAAGG
ATGGTCTTATTGTTGAAACCTTGACGGTGGGGTGTAAAGGGTCAAAGGCTGGTATTGAACAAGAAGGATATTGGTTGCC
AGGAGATGAGATTAGCATCAAGAAGAAAAACACAAGTAAACAAGAGATGAGCACATACCTGCGGTTCATAGTCTCTCGT
ATGAAGGAGCGGGCTATAGATCTAAACAAGAAAGGGAAGGACAACAAACACCCAATGTATAGGAGGCTGGTGCACTCAG
CTGTTGATGTTCCTACCATAAAGGAGAAGGAAAGAGAAAAGGAGAAGGAAAGAGAAAAGGAGAAGAAAAAAAG
Commentsno specific expression detected stages 4-20
no images
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.10687

Mouse

EmageMGI:1913755
EurexpressMGI:1913755
MGI GXDMGI:1913755

Frog

Xenbase960938

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-050522-301
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona