GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

EZH2
enhancer of zeste 2 polycomb repressive complex 2 subunit

Gene
Official SymbolEZH2
Official Full Nameenhancer of zeste 2 polycomb repressive complex 2 subunit
CGNC ID9422
also known ashistone-lysine N-methyltransferase EZH2|enhancer of zeste homolog 2, Enhancer of zeste homolog 2 (ENX-1)
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNAXM_418879
PolypeptideXP_418879
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.4473
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly39203FBgn0000629
Human2146ENSG00000106462MIM:601573
Mouse14056ENSMUSG00000029687All phenotypic alleles (11):Targeted, knock-out(4) Targeted, other(7) MGI:107940
Xenopus550047, 399174, 443646956214
Zebrafish768133ENSDARG00000010571ZDB-GENE-041111-259ZFIN:ZDB-GENE-041111-259
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene420784
Ensembl Gene
KEGGgga:420784

Entry 1

GEISHA IdF18Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCCGCACAACAAAATTTTATGGTAGAGGATGAAACTGTTTTACATAACATTCCATATATGGGAGATGAAGTGCTTGACC
AGGATGGTACCTTTATTGAAGAGCTGATAAAGAACTATGATGGGAAAGTGCATGGAGATAGAGAGTGTGGATTTATCAA
TGAATGCCAAAACAGGTTTCCTGGATGTCGTGGTCAAAGCACAATGGTCAACACTAAGCAGTGTCCATGATGACCTAGA
TGATCGATGAATGATGATCATGATCTCTGATGAAAGAGATGGAGCAAGCAAAACACATCGGGACAGCTAACAGAATAGA
TTCTTGAAAGAAATGTCACCCATCCACGAGAGGATTCCATCTGACAAAACACTTGAAGCCATTGGCACTCAATGTTTCC
AGATAAGTGGTACAGGCTGGAAGAATTGAAAGAGAAATACAAAGAACTCACTGAACAGCAACTTCAAGGAACTCATCCT
CCTGAATGCACACCTAACATGAGATGGATTTCTCAAGATGCTAAGGCAGATCAGAAGAGGAGCAAAGCCTGCATACTGA
TCAAGTACACTTTTCTGCAGGCGTTCTGTTTTAAATATGAATAATGATTCTTACATCCATTCCATGCAACACGCAAGGG
ATACTTACAAAAGAATAGAATAGCAGAAACAGCATTCAGATAATAACCCAACTGCTGGACCGCAAAAGTTATCAGCATC
TGGTTAATGGTGATCACAGAATAGGAATATTTGCTAAAAGATGCCATTCAGACTGCTGAAGAACGCTATTTTGACTACA
GACACCAGCCGAAGCTGATGCCCTTAAGTATGTGGGTAGACGAAAGAGAAATGGAAGACTTCCAAACATGACACCAGCA
GACCTAGCTTTTTACACCAACAATAAAGCTGCCTGATCTTCAGGAAATTCTAGTACTGTGGGCAATTAAGAAAGAAAAA
GCTATTTGAAATTCTGTGTTTGCAAAGTACTGTAACAGTAATTTATAGTAACCAATTTAAAAAAAAAAAAACTTTTTAT
TGCCTTCTCACCAGCTACAGTGTTTTGTATCCTATGACCTTTTGCAATAATGTGGTGTGGTGCATTTTTTTCAATCTTG
AATAAATGATACTTGAACTTCAAAAAAAAAAAAAAAAAAAAA
Commentsno expression detected for stages 14, 17
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-11
stage 11
stage 11
Neural Plate/Tube
 

Entry 2

GEISHA IdChEST995m24Data SourceGEISHA ISH Analysis
Forward cDNA Template Probeshow
GGAGCAGAGGGGATTTATGTAAATGATATTCAAGGATATTAGTGAAAGAGCCTATTAGTAAAGGCAACTACAGACGATG
AGTTGAGCAGAAATTGTAATTTTACTCCATGAAATACTTACAAGCATGAGTAAACTGCTTGAATAGTTAGTCTTGCAAG
GTATTATTTCAAAGATTTCACTGTAACTTAAATAGCAGTAAGTTGTGAAGGTAATTTTGTACGGGGAGAAAAGTGTTGC
ACAGATGGGCAGCTGCTGCTTGCAGGAAATAAAACACTATACTGTGTCAGTTATGGAATACAAGAAATTATTTGGAAAA
AAAAAAACCAACACAACATTGCCTTCTATAAATGTTGGCTTAATTTATTTATGGATCTTGCCCTTGTGGAGTAAGGACA
GAGAAGCTTCAAATGGGAGCTCCTGTGGTAGGAGATAAATAGACTGCAGAGGGTGAGGCAGCAGAAAATTCTGAGTTGC
AGAACAATAAAGTTGCTGTATAAAAAGATATGCCATCTCCTCTGTGTAGAAAGTTGAGCAGTTATATTTTCCAGCTGCT
GAACTCTAAACATATTATAAACATATTAGTCATTAAACAATTACAAAGAAATTGTTTGTAGATGACCTTCCTATCACTT
ATGGTTTTTACTCCTAGATTTTGTGGTTGATGCAACACGCAAGGGAAACAAGATTAGATTTGCAAACCATTCAGTAAAT
CCCAACTGCTATGCAAAAGTTATGATGGTTAATGGTGATCACAGAATAGGAATATTTGCTAAAAGAGCCATTCAGACTG
GTGAAGAACTCTTTTTTGACTACAGATATAGCCAAGCTGAATGCCTTAAGTATGTGGGTATAGAAAGAGAAATGGGAAT
CCCTTGACCCCAGCTACCTCTTCTTAAAACATACAGCTGCTTTATCTTCGGGAAATTCCAGTACTGTGGGCATTTAAAA
AAAAAAAGCTTTTTGAAATCTGGGGTTGCAAAGACTGTAACAGTTATTTTTGGTACCAATTTAAAAAAAAAAAAACTTT
TTTTGGCCTTCCCCCACCCACGGGGTTTGTGCCTATAACCTTTGGCAAAAGGGGGGGGGGGCATTTTTTTCAACTGGAA
AAAGAAACTTGACTTCCCAAAAAAAAAT
Commentsno specific expression detected stages 13-20.
no images

Entry 3

GEISHA IdEZH2.UApcrData SourceGEISHA ISH Analysis
Forward cDNA Template Primer5’-TGAACAGCAGCTTCCAGGAG-3’
Reverse cDNA Template Primer5’-AATTAACCCTCACTAAAGGAGGCTGACGTGGATGATCAC-3’cDNA Template Length844
Complete cDNA Template Probeshow
TGAACAGCAGCTTCCAGGAGCTCTTCCTCCTGAATGCACACCTAACATAGATGGACCAAATGCTAAGTCTGTTCAGAGG
GAGCAAAGCCTGCATTCTTTTCATACACTTTTCTGTAGGCGCTGTTTTAAATATGATTGCTTCTTACATCCATTCCATG
CAACTCCAAATACTTACAAAAGAAAGAATACAGAAACAGCATTAGATAATAAGCCCTGTGGACCGCACTGTTATCAGCA
TCTGGAAGGTGCAAAGGAGTTTGCAGCTGCCCTGACTGCTGAGCGTATAAAGACACCACCGAAGCGCCCAGGTGGTCGC
CGAAGGGGAAGACTTCCAAACAACACCAGCAGACCTAGCACACCAACAATAAATGTGTTGGAATCAAAAGACACAGACA
GTGACAGAGAAGCTGGAACAGAAACTGGAGGAGAAAACAATGATAAAGAGGAAGAAGAAAAGAAAGATGAAACATCCAG
TTCTTCTGAAGCAAATTCTAGGTGTCAAACACCAATAAAGATGAAGCCAAATATTGAGCCTCCGGAGAATGTGGAATGG
AGTGGTGCAGAAGCCTCAATGTTTAGAGTTCTTATTGGCACCTACTATGACAACTTCTGTGCAATCGCCAGACTAATTG
GGACCAAAACATGCAGACAGGTGTATGAGTTTAGAGTAAAAGAATCTAGTATTATTGCTCCGGTCCCTGCTGAAGATGT
TGATACTCCTCCCAGAAAGAAGAAAAGGAAACACAGGTTGTGGGCTGCTCATTGCAGAAAGATACAGCTGAAAAAGGAT
GGTTCATCAAATCATGTTTACAACTATCAGCCATGTGATCATCCACGTCAGCCT
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 4
stage 6
Early Endoderm
Early Mesoderm
Epiblast
Extraembryonic Mesoderm
Lateral Plate Mesoderm
Neural Plate/Tube
Primitive Streak
 
7-12
stage 7
stage 8
stage 9
stage 11
Anterior Intestinal Portal
Aorta
Blood Islands
Forebrain
Foregut
Head Mesenchyme
Headfold
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Midbrain
Neural Plate/Tube
Primitive Streak
Somites
extraembryonic ectoderm
extraembryonic endoderm
extraembryonic mesoderm
 
13-18
stage 16
stage 17
Foregut
Head Mesenchyme
Hindbrain
Intermediate Mesoderm
Lateral Plate Mesoderm
Liver
Lung
Pharyngeal Arches and Clefts
Sclerotome
Somites
 
19-24
stage 23
stage 23
Widespread Expression
 
25
stage 25
stage 25
stage 25
Widespread Expression
 
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.4473

Mouse

EmageMGI:107940
EurexpressMGI:107940
MGI GXDMGI:107940

Frog

Xenbase956214

Fruit Fly

BDGPFBgn0000629

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-041111-259
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona