GEISHA - A Chicken Embryo Gene Expression Database
Browse By
- Anatomical Location
- Stage
- Gene Name
- GEISHA ID
- Multiple Parameters
Search
- Quick Search
Data Class
Enter Text:
go
- Gene Family QuickSearch
Transcription Factors
Growth Factors
Receptors
MicroRNAs
- Human Disease Gene Search
Documents
- Downloads
- Protocols
- About GEISHA
- Contact Us
Resources
- Transgenic Birds
- Model Organism Databases
- Gene Expression Databases
- Genomic Resources
- Anatomical Atlases
- Chicken Stage Series
_

DLX3
distal-less homeobox 3

Gene
Official SymbolDLX3
Official Full Namedistal-less homeobox 3
CGNC ID49390
also known ashomeobox protein DLX-3|DLX3 homeodomain containing protein
gene typeprotein-coding
Genomic Map
 Ensembl ID not known
NCBI
UCSC
Gallus-Browse
Sequence Information
Genomic
RNANM_204804
PolypeptideNP_990135
Sequence Clusters/ESTsUnigene
Gene Expression
In Situ HybridizationGEISHA
EST ProfileGga.326
Orthology
Entrez GeneEnsembl GeneGenetic PhenotypesMOD
Fruit Fly
Human1747ENSG00000064195MIM:600525
Mouse13393ENSMUSG00000001510MGI:94903
Xenopus594954, 779428, 3943275879292
Zebrafish30585ENSDARG00000014626ZDB-GENE-980526-280ZFIN:ZDB-GENE-980526-280
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Links to other databases
Entrez Gene395590
Ensembl Gene
KEGGgga:395590

Entry 1

GEISHA IdDlx3.Zhu.2006Data SourcePublication
Complete cDNA Template Probeshow
ATGAGCGGCTCCTTCGACAAGAAGCTCTCCAGCATCCTCACCGACCTGTCGGGCTCGCTGAGCTGCCATGCCTCCTCCA
AGGACTCCCCGACGCTGCCCGAGTCCTCCGTCACCGACCTGGGCTATTACAGCGGCCAGCACGACTACTACCCGGGCCA
GTCCTACGGGCAGCCCGTCGCCCACTACCCCTACCCCCAATTCAACCTCAACGCCATCGGTGCCGGCGGAAACTATTCC
CCCAAATCCGACTATTCCTACAGCCCGTCCTACCGTCAGTACGGCCACTTCAGGGACCAGCAGCTCCCGGCGCAGGACG
CAGTGTCGGTGAAGGAAGAGCCGGAGCCCGAGGTGCGGATGGTCAACGGGAAACCCAAGAAGATCCGCAAACCCCGCAC
CATCTACTCCAGTTACCAACTGGCCGCCCTGCAGCGCCGCTTCCAGAAAGCCCAATACCTGGCGCTGCCCGAACGCGCC
GAGCTGGCGGCACAGCTGGGGCTCACCCAGACCCAGGTGAAGATCTGGTTCCAGAACCGCCGCTCCAAGTTCAAGAAGC
TCTACAAGAACGGCGAGGTGCCGTTGGAGCACAGCCCCAACAACAGCGATTCCATGGCCTGCAACTCCCCACCGTCGCC
CGCCGTTTGGGACAGTGCCACTCACGGCAGCGCGCCGGGACGGACCCCCCTCCCGCAGCCACTGCCCTACAGCCCCTCG
CCCGCCTTCCTGGAGGAGCACAGCCCCTGGTACCACCCGCAGAGCCTCGCCGCCCCCCACCAGCCGCCCGCCGCCATGC
ACCACACCTCGCCGGGGCCGCCCCCCAACCCGGGCGCCGTTTACTAA
CitationZhu H, Bendall AJ. Dlx3 is expressed in the ventral forebrain of chicken embryos: implications for the evolution of the Dlx gene family. Int J Dev Biol. 2006;50(1):71-5.
Copyright"Reprinted from Int. J. Dev. Biol. Copyright © 2007 UBC Press". All rights reserved.
CommentsDlx3 forward: 5’-ATGAGCGGCTCCTTCGAC-3’; Dlx3 reverse: 5’-TTAGTAAACGGCGCCCGG-3. Intervening sequence was taken from Acc. # NM_204804.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
25-29
stage 27
stage 27
stage 28
stage 29
stage 29
Diencephalon
Forebrain
Pharyngeal Arches and Clefts
Telencephalon
Hypothalamus
Sub-ventricular zone
Thalamus
Ventral thalamus

Entry 2

GEISHA IdDLX2.Vieira.2005Data SourcePublication
Complete cDNA Template Probeshow
ATGAAAGCGGCTCTGCGGGACGGGTCGCGCGGACATCTGCAGAAGCGGCACCCGGCGGTCGCTTCCGTGCAGCTGCCGC
CCCGCGCGGGGGCAGGCGGGGATGGGCGGCAGCTGCCCCGCGTCGGGCGGCCTCAGGGCGGGCTCGCGCCGCTCTGCGG
GAAGCGGCACAGCAGGTATTTTGCCAACCTGCAGCCCTCAAGACCTCAGGTTCCATGCCCCTACGCGCCCGGCGCCGCC
CCCTTCCCCGCCAAGCCGGGCTACGACCCGGGCTACGCGGCCGCGTACGGCTCCTACGGGCCCTACGGCGCCGGGGCCT
CGCCGGCCGCCAACGACTCCGAGAAGGAGGAGTGCGAGCCCGAGGTGCGGATCGTCAACGGGAAGCCCAAGAAGGTCCG
CAAGCCGCGCACCATCTACTCCAGCTTCCAGCTGGAGGCCCTGCAGCGCCGCTTCCAGAAGACGCAGTACCTGGCGCTG
CCCGAGCGCGCCGAGCTGGCCGCCTCCTAAGGCCTCACCCNGACCCAGAGGGGCGGCCCCGATTGTCCCCCGGCCGCGC
TCCGTCAGCTGCCGCCGGCGGGGACGCGCCGCGTCGCATCTGTGCCCGAAGCGGGAGGGCCCGGCCGGCGGCTGGGGAG
GTGCGCAATTAACGCCGTGGGTGTCCGCCGCTTTGTTGGGGAACGGTCTCCCCCGCTCCCTGCGGCCGCCCGGAGGGCT
CCGGGCCGCGGTGCGGGGCAGCTCGGGCTTTTCCCGCTGGCACTAACGCGGCTGAGGAGGAAGTGCCGCTGTTGGTGCG
GAGCGCCGCTCGTCAGTGCCGTTCGTGCCGGGCAGCAACAGCGCGCTCCTTGCCCCGCGGAGCTCTCCGTGCGGGCAGC
TTTGTCCGGGTTGGCGCGGGTCTCATTTGCCAGTGGCAGTAGCCGCCGGGACTTTAATGTACTTGGCTGTCTTGATGCT
CTAGCGTCATCTTTTGTGATGCTTTGCTATGTTTCTGTTGTCTTTCTGACAACAGTTGAGCCTTCATGCCCATTTTTCT
TGGCAAAACGTATTATTGCCCAAAAATTGTCCCCTGTTTACCCTTTCCCCAAGCCCTGCACAGTGCAGCTTCTGGCCGT
GCAAGCTGCTACAGATTGGGTGTCAGTCCTAGCTGTCAGGTTTGGGGAATTTCCCCATGCTACGTTTTAA
CitationVieira C, Garda AL, Shimamura K, Martinez S. Thalamic development induced by Shh in the chick embryo. Dev Biol. 2005 Aug 15;284(2):351-63.
CopyrightCopyright © 2005 Elsevier Inc. All rights reserved.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (XM_426580).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
13-18
stage 17
Central Nervous System
Prethalamus
19-24
stage 23
stage 23
Central Nervous System
Prethalamus
25
stage 25
stage 25
Central Nervous System
Prethalamus
Zona limitans intrathalamica

Entry 3

GEISHA IdDLX2.Bell.2001Data SourcePublication
Complete cDNA Template Probeshow
ATGAAAGCGGCTCTGCGGGACGGGTCGCGCGGACATCTGCAGAAGCGGCACCCGGCGGTCGCTTCCGTGCAGCTGCCGC
CCCGCGCGGGGGCAGGCGGGGATGGGCGGCAGCTGCCCCGCGTCGGGCGGCCTCAGGGCGGGCTCGCGCCGCTCTGCGG
GAAGCGGCACAGCAGGTATTTTGCCAACCTGCAGCCCTCAAGACCTCAGGTTCCATGCCCCTACGCGCCCGGCGCCGCC
CCCTTCCCCGCCAAGCCGGGCTACGACCCGGGCTACGCGGCCGCGTACGGCTCCTACGGGCCCTACGGCGCCGGGGCCT
CGCCGGCCGCCAACGACTCCGAGAAGGAGGAGTGCGAGCCCGAGGTGCGGATCGTCAACGGGAAGCCCAAGAAGGTCCG
CAAGCCGCGCACCATCTACTCCAGCTTCCAGCTGGAGGCCCTGCAGCGCCGCTTCCAGAAGACGCAGTACCTGGCGCTG
CCCGAGCGCGCCGAGCTGGCCGCCTCCTAAGGCCTCACCCNGACCCAGAGGGGCGGCCCCGATTGTCCCCCGGCCGCGC
TCCGTCAGCTGCCGCCGGCGGGGACGCGCCGCGTCGCATCTGTGCCCGAAGCGGGAGGGCCCGGCCGGCGGCTGGGGAG
GTGCGCAATTAACGCCGTGGGTGTCCGCCGCTTTGTTGGGGAACGGTCTCCCCCGCTCCCTGCGGCCGCCCGGAGGGCT
CCGGGCCGCGGTGCGGGGCAGCTCGGGCTTTTCCCGCTGGCACTAACGCGGCTGAGGAGGAAGTGCCGCTGTTGGTGCG
GAGCGCCGCTCGTCAGTGCCGTTCGTGCCGGGCAGCAACAGCGCGCTCCTTGCCCCGCGGAGCTCTCCGTGCGGGCAGC
TTTGTCCGGGTTGGCGCGGGTCTCATTTGCCAGTGGCAGTAGCCGCCGGGACTTTAATGTACTTGGCTGTCTTGATGCT
CTAGCGTCATCTTTTGTGATGCTTTGCTATGTTTCTGTTGTCTTTCTGACAACAGTTGAGCCTTCATGCCCATTTTTCT
TGGCAAAACGTATTATTGCCCAAAAATTGTCCCCTGTTTACCCTTTCCCCAAGCCCTGCACAGTGCAGCTTCTGGCCGT
GCAAGCTGCTACAGATTGGGTGTCAGTCCTAGCTGTCAGGTTTGGGGAATTTCCCCATGCTACGTTTTAA
CitationBell E, Ensini M, Gulisano M, Lumsden A. Dynamic domains of gene expression in the early avian forebrain. Dev Biol. 2001 Aug 1;236(1):76-88.
CopyrightCopyright © 2001 Academic Press All rights reserved.
CommentsInformation provided was insufficient to verify exact sequence used to synthesize probe. The sequence below was obtained from NCBI (XM_426580).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
19-20
stage 20
stage 20
stage 20
stage 20
stage 20
Telencephalon
Expression of dorsal-expressed genes, Emx1, Emx2, Pax6 in relation to a ventral-expressed gene, Dlx2.
Ventral Telecephalon (subpallium)

Entry 4

GEISHA IdDLX3.Khudyakov.2009Data SourcePublication
Complete cDNA Template Probeshow
GCCTCTCAGCGGGAGCGCATCGGGGTACGTTGTGGGCAGCGGGGGGTCCCGGGCGGGCGGCAGCCCCCCGAGCGGCAGC
GATGAGCGGCTCCTTCGACAAGAAGCTCTCCAGCATCCTCACCGACCTGTCGGGCTCGCTGAGCTGCCATGCCTCCTCC
AAGGACTCCCCGACGCTGCCCGAGTCCTCCGTCACCGACCTGGGCTATTACAGCGGCCAGCACGACTACTACCCGGGCC
AGTCCTACGGGCAGCCCGTCGCCCACTACCCCTACCCCCAATTCAACCTCAACGCCATCGGTGCCGGCGGAAACTATTC
CCCCAAATCCGACTATTCCTACAGCCCGTCCTACCGTCAGTACGGCCACTTCAGGGACCAGCAGCTCCCGGCGCAGGAC
GCAGTGTCGGTGAAGGAAGAGCCGGAGCCCGAGGTGCGGATGGTCAACGGGAAACCCAAGAAGATCCGCAAACCCCGCA
CCATCTACTCCAGTTACCAACTGGCCGCCCTGCAGCGCCGCTTCCAGAAAGCCCAATACCTGGCGCTGCCCGAACGCGC
CGAGCTGGCGGCACAGCTGGGGCTCACCCAGACCCAGGTGAAGATCTGGTTCCAGAACCGCCGCTCCAAGTTCAAGAAG
CTCTACAAGAACGGCGAGGTGCCGTTGGAGCACAGCCCCAACAACAGCGATTCCATGGCCTGCAACTCCCCACCGTCGC
CCGCCGTTTGGGACAGTGCCACTCACGGCAGCGCGCCGGGACGGACCCCCCTCCCGCAGCCACTGCCCTACAGCCCCTC
GCCCGCCTTCCTGGAGGAGCACAGCCCCTGGTACCACCCGCAGAGCCTCGCCGCCCCCCACCAGCCGCCCGCCGCCATG
CACCACACCTCGCCGGGGCCGCCCCCCAACCCGGGCGCCGTTTACTAACCGTGGGGGCAGAGACAGTGCGGAACTCCTT
CTCTCTTCCCTTTCTCCCACTCAGCCCCCCCCCATCCCCGCCCCCTCAGCCCCCCAATGATGATTATTTTTTAAAGTGT
TCCAGGACACGCGCCCCTATGTACCCACCTCTATATCCTCTCCTCTCCCAGCTCATCTCAGGAACAACGGGACTGCAAA
GGGTTGAACTCGTGAGCTCTGCGCCCAGGGGACACCACCGCTGC
CitationKhudyakov J, Bronner-Fraser M. Comprehensive spatiotemporal analysis of early chick neural crest network genes. Dev Dyn. 2009 Mar;238(3):716-23.
CopyrightPublished Online: 22 Feb 2009 Copyright © 2009 Wiley-Liss, Inc.
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204804)
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
4-6
stage 4
stage 5
stage 6
Ectoderm
Headfold
Neural Plate/Tube
Placcode
Preplacodal region
7-10
stage 7
stage 7
stage 8
stage 9
stage 10
stage 10
Ear/Otic Placcode
Ectoderm
Headfold
Nasal Placcode/Nerve
Neural Plate/Tube
Placcode
Non-neural ectoderm
Preplacodal region

Entry 5

GEISHA IdDLX3.Bhattacharyya.2008Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCCTCTCAGCGGGAGCGCATCGGGGTACGTTGTGGGCAGCGGGGGGTCCCGGGCGGGCGGCAGCCCCCCGAGCGGCAGC
GATGAGCGGCTCCTTCGACAAGAAGCTCTCCAGCATCCTCACCGACCTGTCGGGCTCGCTGAGCTGCCATGCCTCCTCC
AAGGACTCCCCGACGCTGCCCGAGTCCTCCGTCACCGACCTGGGCTATTACAGCGGCCAGCACGACTACTACCCGGGCC
AGTCCTACGGGCAGCCCGTCGCCCACTACCCCTACCCCCAATTCAACCTCAACGCCATCGGTGCCGGCGGAAACTATTC
CCCCAAATCCGACTATTCCTACAGCCCGTCCTACCGTCAGTACGGCCACTTCAGGGACCAGCAGCTCCCGGCGCAGGAC
GCAGTGTCGGTGAAGGAAGAGCCGGAGCCCGAGGTGCGGATGGTCAACGGGAAACCCAAGAAGATCCGCAAACCCCGCA
CCATCTACTCCAGTTACCAACTGGCCGCCCTGCAGCGCCGCTTCCAGAAAGCCCAATACCTGGCGCTGCCCGAACGCGC
CGAGCTGGCGGCACAGCTGGGGCTCACCCAGACCCAGGTGAAGATCTGGTTCCAGAACCGCCGCTCCAAGTTCAAGAAG
CTCTACAAGAACGGCGAGGTGCCGTTGGAGCACAGCCCCAACAACAGCGATTCCATGGCCTGCAACTCCCCACCGTCGC
CCGCCGTTTGGGACAGTGCCACTCACGGCAGCGCGCCGGGACGGACCCCCCTCCCGCAGCCACTGCCCTACAGCCCCTC
GCCCGCCTTCCTGGAGGAGCACAGCCCCTGGTACCACCCGCAGAGCCTCGCCGCCCCCCACCAGCCGCCCGCCGCCATG
CACCACACCTCGCCGGGGCCGCCCCCCAACCCGGGCGCCGTTTACTAACCGTGGGGGCAGAGACAGTGCGGAACTCCTT
CTCTCTTCCCTTTCTCCCACTCAGCCCCCCCCCATCCCCGCCCCCTCAGCCCCCCAATGATGATTATTTTTTAAAGTGT
TCCAGGACACGCGCCCCTATGTACCCACCTCTATATCCTCTCCTCTCCCAGCTCATCTCAGGAACAACGGGACTGCAAA
GGGTTGAACTCGTGAGCTCTGCGCCCAGGGGACACCACCGCTGC
CommentsInsufficient information provided in publication to verify exact sequence used to synthesize probe. Sequence below was obtained from NCBI (NM_204804).
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 8
stage 10
Ectoderm
Nasal Placcode/Nerve
Neural Plate/Tube
Ectoderm adjacent to anterior neural folds
Olfactory progenitors
13-18
stage 13
stage 13
Ectoderm
Nasal Placcode/Nerve
Nasal progenitors
19-20
stage 20
stage 20
Ear/Otic Placcode
Nasal Placcode/Nerve
Pharyngeal Arches and Clefts
 

Entry 6

GEISHA IdDLX2.Blentic.2008Data SourcePublication
Complete cDNA Template Probeshow
GCCTCTCAGCGGGAGCGCATCGGGGTACGTTGTGGGCAGCGGGGGGTCCCGGGCGGGCGGCAGCCCCCCGAGCGGCAGC
GATGAGCGGCTCCTTCGACAAGAAGCTCTCCAGCATCCTCACCGACCTGTCGGGCTCGCTGAGCTGCCATGCCTCCTCC
AAGGACTCCCCGACGCTGCCCGAGTCCTCCGTCACCGACCTGGGCTATTACAGCGGCCAGCACGACTACTACCCGGGCC
AGTCCTACGGGCAGCCCGTCGCCCACTACCCCTACCCCCAATTCAACCTCAACGCCATCGGTGCCGGCGGAAACTATTC
CCCCAAATCCGACTATTCCTACAGCCCGTCCTACCGTCAGTACGGCCACTTCAGGGACCAGCAGCTCCCGGCGCAGGAC
GCAGTGTCGGTGAAGGAAGAGCCGGAGCCCGAGGTGCGGATGGTCAACGGGAAACCCAAGAAGATCCGCAAACCCCGCA
CCATCTACTCCAGTTACCAACTGGCCGCCCTGCAGCGCCGCTTCCAGAAAGCCCAATACCTGGCGCTGCCCGAACGCGC
CGAGCTGGCGGCACAGCTGGGGCTCACCCAGACCCAGGTGAAGATCTGGTTCCAGAACCGCCGCTCCAAGTTCAAGAAG
CTCTACAAGAACGGCGAGGTGCCGTTGGAGCACAGCCCCAACAACAGCGATTCCATGGCCTGCAACTCCCCACCGTCGC
CCGCCGTTTGGGACAGTGCCACTCACGGCAGCGCGCCGGGACGGACCCCCCTCCCGCAGCCACTGCCCTACAGCCCCTC
GCCCGCCTTCCTGGAGGAGCACAGCCCCTGGTACCACCCGCAGAGCCTCGCCGCCCCCCACCAGCCGCCCGCCGCCATG
CACCACACCTCGCCGGGGCCGCCCCCCAACCCGGGCGCCGTTTACTAACCGTGGGGGCAGAGACAGTGCGGAACTCCTT
CTCTCTTCCCTTTCTCCCACTCAGCCCCCCCCCATCCCCGCCCCCTCAGCCCCCCAATGATGATTATTTTTTAAAGTGT
TCCAGGACACGCGCCCCTATGTACCCACCTCTATATCCTCTCCTCTCCCAGCTCATCTCAGGAACAACGGGACTGCAAA
GGGTTGAACTCGTGAGCTCTGCGCCCAGGGGACACCACCGCTGC
CitationBlentic A, Tandon P, Payton S, Walshe J, Carney T, Kelsh RN, Mason I, Graham A. The emergence of ectomesenchyme. Dev Dyn. 2008 Mar;237(3):592-601.
CopyrightCopyright © 2008 John Wiley & Sons, Inc. All Rights Reserved.
CommentsAuthors did not indicate the probe sequence or accession number. Currently no sequence available.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 10
stage 11
stage 11
Neural Crest
Neural Plate/Tube
 
13-18
stage 14
stage 15
stage 15
stage 15
stage 15
Neural Crest
Pharyngeal Arches and Clefts
 
19
stage 19
Neural Crest
Pharyngeal Arches and Clefts
 

Entry 7

GEISHA IdDLX3.Freter.2012Data SourcePublication
Complete cDNA Template Probeshow
GCCTCTCAGCGGGAGCGCATCGGGGTACGTTGTGGGCAGCGGGGGGTCCCGGGCGGGCGGCAGCCCCCCGAGCGGCAGC
GATGAGCGGCTCCTTCGACAAGAAGCTCTCCAGCATCCTCACCGACCTGTCGGGCTCGCTGAGCTGCCATGCCTCCTCC
AAGGACTCCCCGACGCTGCCCGAGTCCTCCGTCACCGACCTGGGCTATTACAGCGGCCAGCACGACTACTACCCGGGCC
AGTCCTACGGGCAGCCCGTCGCCCACTACCCCTACCCCCAATTCAACCTCAACGCCATCGGTGCCGGCGGAAACTATTC
CCCCAAATCCGACTATTCCTACAGCCCGTCCTACCGTCAGTACGGCCACTTCAGGGACCAGCAGCTCCCGGCGCAGGAC
GCAGTGTCGGTGAAGGAAGAGCCGGAGCCCGAGGTGCGGATGGTCAACGGGAAACCCAAGAAGATCCGCAAACCCCGCA
CCATCTACTCCAGTTACCAACTGGCCGCCCTGCAGCGCCGCTTCCAGAAAGCCCAATACCTGGCGCTGCCCGAACGCGC
CGAGCTGGCGGCACAGCTGGGGCTCACCCAGACCCAGGTGAAGATCTGGTTCCAGAACCGCCGCTCCAAGTTCAAGAAG
CTCTACAAGAACGGCGAGGTGCCGTTGGAGCACAGCCCCAACAACAGCGATTCCATGGCCTGCAACTCCCCACCGTCGC
CCGCCGTTTGGGACAGTGCCACTCACGGCAGCGCGCCGGGACGGACCCCCCTCCCGCAGCCACTGCCCTACAGCCCCTC
GCCCGCCTTCCTGGAGGAGCACAGCCCCTGGTACCACCCGCAGAGCCTCGCCGCCCCCCACCAGCCGCCCGCCGCCATG
CACCACACCTCGCCGGGGCCGCCCCCCAACCCGGGCGCCGTTTACTAACCGTGGGGGCAGAGACAGTGCGGAACTCCTT
CTCTCTTCCCTTTCTCCCACTCAGCCCCCCCCCATCCCCGCCCCCTCAGCCCCCCAATGATGATTATTTTTTAAAGTGT
TCCAGGACACGCGCCCCTATGTACCCACCTCTATATCCTCTCCTCTCCCAGCTCATCTCAGGAACAACGGGACTGCAAA
GGGTTGAACTCGTGAGCTCTGCGCCCAGGGGACACCACCGCTGC
CitationFreter S, Muta Y, O'Neill P, Vassilev VS, Kuraku S, Ladher RK. Pax2 modulates proliferation during specification of the otic and epibranchial placodes. Dev Dyn. 2012 Nov;241(11):1716-28
CopyrightCopyright © 2012 Wiley Periodicals, Inc.
CommentsThe complete cDNA template sequence was obtained from the information provided in the publication as described in Freter et al., 2012 and Brown et al., 2005.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-10
stage 10
stage 10
Ectoderm
Neural Plate/Tube
control = is left side of embryo
control = left side of embryo
all
 
  

Entry 8

GEISHA IdDLX3.Brown.2005Data SourceGEISHA ISH Analysis
Complete cDNA Template Probeshow
GCCTCTCAGCGGGAGCGCATCGGGGTACGTTGTGGGCAGCGGGGGGTCCCGGGCGGGCGGCAGCCCCCCGAGCGGCAGC
GATGAGCGGCTCCTTCGACAAGAAGCTCTCCAGCATCCTCACCGACCTGTCGGGCTCGCTGAGCTGCCATGCCTCCTCC
AAGGACTCCCCGACGCTGCCCGAGTCCTCCGTCACCGACCTGGGCTATTACAGCGGCCAGCACGACTACTACCCGGGCC
AGTCCTACGGGCAGCCCGTCGCCCACTACCCCTACCCCCAATTCAACCTCAACGCCATCGGTGCCGGCGGAAACTATTC
CCCCAAATCCGACTATTCCTACAGCCCGTCCTACCGTCAGTACGGCCACTTCAGGGACCAGCAGCTCCCGGCGCAGGAC
GCAGTGTCGGTGAAGGAAGAGCCGGAGCCCGAGGTGCGGATGGTCAACGGGAAACCCAAGAAGATCCGCAAACCCCGCA
CCATCTACTCCAGTTACCAACTGGCCGCCCTGCAGCGCCGCTTCCAGAAAGCCCAATACCTGGCGCTGCCCGAACGCGC
CGAGCTGGCGGCACAGCTGGGGCTCACCCAGACCCAGGTGAAGATCTGGTTCCAGAACCGCCGCTCCAAGTTCAAGAAG
CTCTACAAGAACGGCGAGGTGCCGTTGGAGCACAGCCCCAACAACAGCGATTCCATGGCCTGCAACTCCCCACCGTCGC
CCGCCGTTTGGGACAGTGCCACTCACGGCAGCGCGCCGGGACGGACCCCCCTCCCGCAGCCACTGCCCTACAGCCCCTC
GCCCGCCTTCCTGGAGGAGCACAGCCCCTGGTACCACCCGCAGAGCCTCGCCGCCCCCCACCAGCCGCCCGCCGCCATG
CACCACACCTCGCCGGGGCCGCCCCCCAACCCGGGCGCCGTTTACTAACCGTGGGGGCAGAGACAGTGCGGAACTCCTT
CTCTCTTCCCTTTCTCCCACTCAGCCCCCCCCCATCCCCGCCCCCTCAGCCCCCCAATGATGATTATTTTTTAAAGTGT
TCCAGGACACGCGCCCCTATGTACCCACCTCTATATCCTCTCCTCTCCCAGCTCATCTCAGGAACAACGGGACTGCAAA
GGGTTGAACTCGTGAGCTCTGCGCCCAGGGGACACCACCGCTGC
CitationStephen T Brown 1, Juemei Wang, Andrew K Groves. Dlx gene expression during chick inner ear development. J Comp Neurol. 2005 Feb 28;483(1):48-65.0
Copyright© 2005 Wiley-Liss, Inc.
CommentsThe complete cDNA template sequence was obtained from the information provided in the publication as described in Brown et al., 2005.
StageImage (click image to view full size)Location (click to highlight)Comments (click to highlight)
7-12
stage 9
stage 11
stage 12
Ear/Otic Placode
Ectoderm
 
13-18
stage 13
stage 15
stage 18
Ear/Otic Placode
Face Mesenchyme
Nasal Placode/Nerve
Pharyngeal Arches and Clefts
 
19-24
stage 21
stage 24
Ear/Otic Placode
Stage 24+
25-30
stage 30
Ear/Otic Placode
es, endolymphatic sac
all
 
 
 
 
  
 Data from NCBI Unigene EST Profile
Unigene ID: Gga.326

Mouse

EmageMGI:94903
EurexpressMGI:94903
MGI GXDMGI:94903

Frog

Xenbase5879292

Fruit Fly

BDGP

Zebra Finch

ZEBrA

Zebrafish

ZFINZDB-GENE-980526-280
Home | Contact
     
© 2008 Arizona Board of Regents
This website is hosted by the Biotechnology Computing Facility at the University of Arizona